EMAIL THIS PAGE TO A FRIEND

SETX

senataxin

135 Gene Product Result for
Synonyms: ALS4 AOA2 SCAR1 bA479K20.2
Gene ID:
Human(23064) Summary: This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
Mouse(269254) senataxin
Rat(362096) senataxin
Zebrafish(562474) senataxin
Horse(100066679) senataxin
chicken(417170) senataxin
dog(480691) senataxin
cow(534284) senataxin
sheep(101113739) senataxin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015046 Rosetta Predictions human pricing
XM_342400 Rosetta Predictions rat pricing
XR_009286 Rosetta Predictions rat pricing
NM_198033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346887 predicted 1793
2 SASI_Hs02_00346888 predicted 8278
3 SASI_Hs01_00095765 predicted 1864
4 SASI_Hs01_00095766 predicted 5273
5 SASI_Hs01_00095767 predicted 3460
6 SASI_Hs01_00095768 predicted 4058
7 SASI_Hs01_00095769 predicted 5934
8 SASI_Hs01_00095770 predicted 7022
9 SASI_Hs02_00346889 predicted 550
10 SASI_Hs01_00095771 predicted 7028
11 SASI_Hs01_00095764 predicted 2238
12 SASI_Hs01_00095772 predicted 3609
13 SASI_Hs01_00095773 predicted 6853
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394227 predicted 7005
2 SASI_Rn02_00394228 predicted 6447
3 SASI_Rn02_00394229 predicted 6938
4 SASI_Rn02_00394230 predicted 6375
5 SASI_Rn02_00394231 predicted 6896
6 SASI_Rn02_00394232 predicted 6970
7 SASI_Rn02_00394233 predicted 6949
8 SASI_Rn02_00394234 predicted 7137
9 SASI_Rn02_00394235 predicted 6773
10 SASI_Rn02_00394236 predicted 7222
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191348 predicted 1051
2 SASI_Rn02_00419295 predicted 1164
3 SASI_Rn02_00419296 predicted 350
4 SASI_Rn02_00419297 predicted 1561
5 SASI_Rn02_00419298 predicted 1123
6 SASI_Rn01_00191356 predicted 361
7 SASI_Rn02_00419299 predicted 923
8 SASI_Rn02_00419300 predicted 714
9 SASI_Rn02_00419301 predicted 251
10 SASI_Rn02_00419302 predicted 446
11 SASI_Rn01_00191347 predicted 7179
12 SASI_Rn01_00191349 predicted 6037
13 SASI_Rn01_00191350 predicted 2230
14 SASI_Rn01_00191351 predicted 6952
15 SASI_Rn01_00191352 predicted 2270
16 SASI_Rn01_00191353 predicted 3733
17 SASI_Rn01_00191354 predicted 2874
18 SASI_Rn01_00191355 predicted 2486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350781 predicted 931
2 SASI_Mm02_00350782 predicted 6108
3 SASI_Mm02_00350783 predicted 5115
4 SASI_Mm02_00350784 predicted 5996
5 SASI_Mm02_00350785 predicted 6096
6 SASI_Mm02_00350786 predicted 3152
7 SASI_Mm01_00107251 predicted 7619
8 SASI_Mm01_00107252 predicted 7455
9 SASI_Mm02_00350787 predicted 2889
10 SASI_Mm02_00350788 predicted 4924
11 SASI_Mm01_00107248 predicted 1058
12 SASI_Mm01_00107249 predicted 910
13 SASI_Mm01_00107250 predicted 651
14 SASI_Mm01_00107253 predicted 806
15 SASI_Mm01_00107254 predicted 383
16 SASI_Mm01_00107255 predicted 991
17 SASI_Mm01_00107256 predicted 1489
18 SASI_Mm01_00107257 predicted 693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015046
SETX MISSION shRNA Bacterial Glycerol Stock
senataxin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015046.5-5161s21c1
Sequence:CCGGCATCCTCAGTCTCCGAATAATCTCGAGATTATTCGGAGACTGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015046.5-3465s21c1
Sequence:CCGGAGATCATCCAGACGATAATAACTCGAGTTATTATCGTCTGGATGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-1311s1c1
Sequence:CCGGCCCAGATTATTGTCCTAACATCTCGAGATGTTAGGACAATAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-388s1c1
Sequence:CCGGCGTCTCATAAATCACTTTGAACTCGAGTTCAAAGTGATTTATGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-3098s1c1
Sequence:CCGGCCAGTGTTATTACGTTCCCATCTCGAGATGGGAACGTAATAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-7324s1c1
Sequence:CCGGCGGCAGAAGGATTGTGTTATTCTCGAGAATAACACAATCCTTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-5285s1c1
Sequence:CCGGCCTTCGTTAAAGAGGTCTTAACTCGAGTTAAGACCTCTTTAACGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015046
SETX MISSION shRNA shRNA Plasmid DNA
senataxin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015046.5-5161s21c1
Sequence:CCGGCATCCTCAGTCTCCGAATAATCTCGAGATTATTCGGAGACTGAGGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000429572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015046.5-3465s21c1
Sequence:CCGGAGATCATCCAGACGATAATAACTCGAGTTATTATCGTCTGGATGATCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-1311s1c1
Sequence:CCGGCCCAGATTATTGTCCTAACATCTCGAGATGTTAGGACAATAATCTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-388s1c1
Sequence:CCGGCGTCTCATAAATCACTTTGAACTCGAGTTCAAAGTGATTTATGAGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-3098s1c1
Sequence:CCGGCCAGTGTTATTACGTTCCCATCTCGAGATGGGAACGTAATAACACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-7324s1c1
Sequence:CCGGCGGCAGAAGGATTGTGTTATTCTCGAGAATAACACAATCCTTCTGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-5285s1c1
Sequence:CCGGCCTTCGTTAAAGAGGTCTTAACTCGAGTTAAGACCTCTTTAACGAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015046
SETX MISSION shRNA Lentiviral Transduction Particles
senataxin
Human
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000435730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015046.5-5161s21c1
Sequence:CCGGCATCCTCAGTCTCCGAATAATCTCGAGATTATTCGGAGACTGAGGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015046.5-3465s21c1
Sequence:CCGGAGATCATCCAGACGATAATAACTCGAGTTATTATCGTCTGGATGATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-1311s1c1
Sequence:CCGGCCCAGATTATTGTCCTAACATCTCGAGATGTTAGGACAATAATCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-388s1c1
Sequence:CCGGCGTCTCATAAATCACTTTGAACTCGAGTTCAAAGTGATTTATGAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-3098s1c1
Sequence:CCGGCCAGTGTTATTACGTTCCCATCTCGAGATGGGAACGTAATAACACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-7324s1c1
Sequence:CCGGCGGCAGAAGGATTGTGTTATTCTCGAGAATAACACAATCCTTCTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015046.4-5285s1c1
Sequence:CCGGCCTTCGTTAAAGAGGTCTTAACTCGAGTTAAGACCTCTTTAACGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198033
SETX MISSION shRNA Bacterial Glycerol Stock
senataxin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198033.1-3873s1c1
Sequence:CCGGCCCAGCTAAGTGGGAAAGAAACTCGAGTTTCTTTCCCACTTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1213s1c1
Sequence:CCGGCCGGTGTTACAGCTTACCATTCTCGAGAATGGTAAGCTGTAACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-499s1c1
Sequence:CCGGGCGGTTGATGAACTTATGAAACTCGAGTTTCATAAGTTCATCAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1705s1c1
Sequence:CCGGCGAGCCAAGTATAGCCTCTTTCTCGAGAAAGAGGCTATACTTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1388s1c1
Sequence:CCGGGACGGGATAATGACTCATATACTCGAGTATATGAGTCATTATCCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198033
SETX MISSION shRNA shRNA Plasmid DNA
senataxin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198033.1-3873s1c1
Sequence:CCGGCCCAGCTAAGTGGGAAAGAAACTCGAGTTTCTTTCCCACTTAGCTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1213s1c1
Sequence:CCGGCCGGTGTTACAGCTTACCATTCTCGAGAATGGTAAGCTGTAACACCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-499s1c1
Sequence:CCGGGCGGTTGATGAACTTATGAAACTCGAGTTTCATAAGTTCATCAACCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1705s1c1
Sequence:CCGGCGAGCCAAGTATAGCCTCTTTCTCGAGAAAGAGGCTATACTTGGCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000115230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1388s1c1
Sequence:CCGGGACGGGATAATGACTCATATACTCGAGTATATGAGTCATTATCCCGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198033
SETX MISSION shRNA Lentiviral Transduction Particles
senataxin
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000115226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198033.1-3873s1c1
Sequence:CCGGCCCAGCTAAGTGGGAAAGAAACTCGAGTTTCTTTCCCACTTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1213s1c1
Sequence:CCGGCCGGTGTTACAGCTTACCATTCTCGAGAATGGTAAGCTGTAACACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-499s1c1
Sequence:CCGGGCGGTTGATGAACTTATGAAACTCGAGTTTCATAAGTTCATCAACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1705s1c1
Sequence:CCGGCGAGCCAAGTATAGCCTCTTTCTCGAGAAAGAGGCTATACTTGGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198033.1-1388s1c1
Sequence:CCGGGACGGGATAATGACTCATATACTCGAGTATATGAGTCATTATCCCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)