EMAIL THIS PAGE TO A FRIEND

SEZ6

seizure related 6 homolog (mouse)

127 Gene Product Result for
Gene ID:
Mouse(20370) seizure related gene 6
Rat(192247) seizure related 6 homolog (mouse)
cow(539038) seizure related 6 homolog (mouse)
sheep(101121277) seizure related 6 homolog (mouse)
domestic guinea pig(100720789) seizure related 6 homolog (mouse)
naked mole-rat(101722479) seizure related 6 homolog (mouse)
Domestic Rabbit(100348018) seizure related 6 homolog (mouse)
Zebrafish(100536906) seizure related 6 homolog (mouse)
dog(491175) seizure related 6 homolog (mouse)
Horse(100072101) seizure related 6 homolog (mouse)
domestic cat(101084326) seizure related 6 homolog (mouse)
chicken(426388) seizure related 6 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098635 Rosetta Predictions human pricing
NM_178860 Rosetta Predictions human pricing
NM_021286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319651 predicted 377
2 SASI_Hs02_00319652 predicted 1248
3 SASI_Hs02_00319653 predicted 2671
4 SASI_Hs02_00319654 predicted 1703
5 SASI_Hs02_00319655 predicted 2218
6 SASI_Hs02_00319656 predicted 1638
7 SASI_Hs02_00319657 predicted 1752
8 SASI_Hs02_00319658 predicted 1701
9 SASI_Hs02_00319659 predicted 1795
10 SASI_Hs02_00319660 predicted 2192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109824 predicted 374
2 SASI_Hs01_00109825 predicted 1248
3 SASI_Hs01_00109828 predicted 2673
4 SASI_Hs02_00369904 predicted 1699
5 SASI_Hs01_00109829 predicted 2213
6 SASI_Hs01_00109830 predicted 1634
7 SASI_Hs01_00109831 predicted 1754
8 SASI_Hs02_00369905 predicted 1702
9 SASI_Hs02_00369906 predicted 1802
10 SASI_Hs02_00369907 predicted 2190
11 SASI_Hs01_00109822 predicted 3497
12 SASI_Hs01_00109823 predicted 1874
13 SASI_Hs01_00109826 predicted 1783
14 SASI_Hs01_00109827 predicted 3393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086702 predicted 2184
2 SASI_Mm01_00086703 predicted 3022
3 SASI_Mm02_00325817 predicted 944
4 SASI_Mm01_00086705 predicted 2589
5 SASI_Mm01_00086706 predicted 1918
6 SASI_Mm01_00086707 predicted 3059
7 SASI_Mm01_00086708 predicted 2340
8 SASI_Mm02_00325818 predicted 1159
9 SASI_Mm01_00086709 predicted 528
10 SASI_Mm01_00086710 predicted 793
11 SASI_Mm01_00086704 predicted 1761
12 SASI_Mm01_00086711 predicted 3190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178860
SEZ6 MISSION shRNA Bacterial Glycerol Stock
seizure related 6 homolog (mouse)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-3094s1c1
Sequence:CCGGGTGTTGTTGGTAGGAGGTGTACTCGAGTACACCTCCTACCAACAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-4008s1c1
Sequence:CCGGGCAAACATCTTCACCCTAATACTCGAGTATTAGGGTGAAGATGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-1320s1c1
Sequence:CCGGCCATTTCCATTACCAAGCCTACTCGAGTAGGCTTGGTAATGGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-3977s1c1
Sequence:CCGGGAGACTTTCCTCCGATGTTTACTCGAGTAAACATCGGAGGAAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-1128s1c1
Sequence:CCGGCGTGGAAATCAAGGTCAAGAACTCGAGTTCTTGACCTTGATTTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178860.4-1791s21c1
Sequence:CCGGTATGAGCCCTTTGTCAAATACCTCGAGGTATTTGACAAAGGGCTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178860.4-3117s21c1
Sequence:CCGGGCGTTTGACAATCCAACTTACCTCGAGGTAAGTTGGATTGTCAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-3837s1c1
Sequence:CCGGGAGGCAGTAATTCTAGGAGATCTCGAGATCTCCTAGAATTACTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-2278s1c1
Sequence:CCGGCGTAGCCACTTCAAGCTCTTTCTCGAGAAAGAGCTTGAAGTGGCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178860
SEZ6 MISSION shRNA shRNA Plasmid DNA
seizure related 6 homolog (mouse)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-3094s1c1
Sequence:CCGGGTGTTGTTGGTAGGAGGTGTACTCGAGTACACCTCCTACCAACAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-4008s1c1
Sequence:CCGGGCAAACATCTTCACCCTAATACTCGAGTATTAGGGTGAAGATGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-1320s1c1
Sequence:CCGGCCATTTCCATTACCAAGCCTACTCGAGTAGGCTTGGTAATGGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-3977s1c1
Sequence:CCGGGAGACTTTCCTCCGATGTTTACTCGAGTAAACATCGGAGGAAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-1128s1c1
Sequence:CCGGCGTGGAAATCAAGGTCAAGAACTCGAGTTCTTGACCTTGATTTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178860.4-1791s21c1
Sequence:CCGGTATGAGCCCTTTGTCAAATACCTCGAGGTATTTGACAAAGGGCTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178860.4-3117s21c1
Sequence:CCGGGCGTTTGACAATCCAACTTACCTCGAGGTAAGTTGGATTGTCAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-3837s1c1
Sequence:CCGGGAGGCAGTAATTCTAGGAGATCTCGAGATCTCCTAGAATTACTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-2278s1c1
Sequence:CCGGCGTAGCCACTTCAAGCTCTTTCTCGAGAAAGAGCTTGAAGTGGCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178860
SEZ6 MISSION shRNA Lentiviral Transduction Particles
seizure related 6 homolog (mouse)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-3094s1c1
Sequence:CCGGGTGTTGTTGGTAGGAGGTGTACTCGAGTACACCTCCTACCAACAACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000151016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-4008s1c1
Sequence:CCGGGCAAACATCTTCACCCTAATACTCGAGTATTAGGGTGAAGATGTTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000155797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-1320s1c1
Sequence:CCGGCCATTTCCATTACCAAGCCTACTCGAGTAGGCTTGGTAATGGAAATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000154984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-3977s1c1
Sequence:CCGGGAGACTTTCCTCCGATGTTTACTCGAGTAAACATCGGAGGAAAGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000155579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-1128s1c1
Sequence:CCGGCGTGGAAATCAAGGTCAAGAACTCGAGTTCTTGACCTTGATTTCCACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178860.4-1791s21c1
Sequence:CCGGTATGAGCCCTTTGTCAAATACCTCGAGGTATTTGACAAAGGGCTCATATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178860.4-3117s21c1
Sequence:CCGGGCGTTTGACAATCCAACTTACCTCGAGGTAAGTTGGATTGTCAAACGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000154733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178860.2-3837s1c1
Sequence:CCGGGAGGCAGTAATTCTAGGAGATCTCGAGATCTCCTAGAATTACTGCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178860.2-2278s1c1
Sequence:CCGGCGTAGCCACTTCAAGCTCTTTCTCGAGAAAGAGCTTGAAGTGGCTACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021286
SEZ6 MISSION shRNA Bacterial Glycerol Stock
seizure related 6 homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-2590s1c1
Sequence:CCGGCCCAAGTGTCTCTTGGAACAACTCGAGTTGTTCCAAGAGACACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-1710s1c1
Sequence:CCGGGCCCTTTGTCAAATACGGCAACTCGAGTTGCCGTATTTGACAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-3031s1c1
Sequence:CCGGGCATTTGACAATCCAACTTATCTCGAGATAAGTTGGATTGTCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021286.2-3591s1c1
Sequence:CCGGCCCTCTCTAAAGGCTCAGAATCTCGAGATTCTGAGCCTTTAGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-1713s1c1
Sequence:CCGGCTTTGTCAAATACGGCAACTTCTCGAGAAGTTGCCGTATTTGACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021286
SEZ6 MISSION shRNA shRNA Plasmid DNA
seizure related 6 homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-2590s1c1
Sequence:CCGGCCCAAGTGTCTCTTGGAACAACTCGAGTTGTTCCAAGAGACACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-1710s1c1
Sequence:CCGGGCCCTTTGTCAAATACGGCAACTCGAGTTGCCGTATTTGACAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-3031s1c1
Sequence:CCGGGCATTTGACAATCCAACTTATCTCGAGATAAGTTGGATTGTCAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021286.2-3591s1c1
Sequence:CCGGCCCTCTCTAAAGGCTCAGAATCTCGAGATTCTGAGCCTTTAGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-1713s1c1
Sequence:CCGGCTTTGTCAAATACGGCAACTTCTCGAGAAGTTGCCGTATTTGACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021286
SEZ6 MISSION shRNA Lentiviral Transduction Particles
seizure related 6 homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-2590s1c1
Sequence:CCGGCCCAAGTGTCTCTTGGAACAACTCGAGTTGTTCCAAGAGACACTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-1710s1c1
Sequence:CCGGGCCCTTTGTCAAATACGGCAACTCGAGTTGCCGTATTTGACAAAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-3031s1c1
Sequence:CCGGGCATTTGACAATCCAACTTATCTCGAGATAAGTTGGATTGTCAAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021286.2-3591s1c1
Sequence:CCGGCCCTCTCTAAAGGCTCAGAATCTCGAGATTCTGAGCCTTTAGAGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000101139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021286.2-1713s1c1
Sequence:CCGGCTTTGTCAAATACGGCAACTTCTCGAGAAGTTGCCGTATTTGACAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???