EMAIL THIS PAGE TO A FRIEND

SF3B3

splicing factor 3b, subunit 3, 130kDa

74 Gene Product Result for
Synonyms: RSE1 SAP130 SF3b130 STAF130
UniProtKB ID: Q15393, Q6NTI8, Q96GC0, Q9BPY2, Q9UFX7, Q9UJ29
Gene ID:
Human(23450) Summary: This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex, and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification, transcription, splicing, and DNA repair. [provided by RefSeq, Jul 2008]
Mouse(101943) splicing factor 3b, subunit 3
Rat(292019) splicing factor 3b, subunit 3
naked mole-rat(101723195) splicing factor 3b, subunit 3, 130kDa
domestic guinea pig(100723277) splicing factor 3b, subunit 3, 130kDa
cow(504962) splicing factor 3b, subunit 3, 130kDa
sheep(101113518) splicing factor 3b, subunit 3, 130kDa
Zebrafish(406824) splicing factor 3b, subunit 3
Horse(100054753) splicing factor 3b, subunit 3, 130kDa
domestic cat(101086362) splicing factor 3b, subunit 3, 130kDa
dog(479659) splicing factor 3b, subunit 3, 130kDa
chicken(415680) splicing factor 3b, subunit 3, 130kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012426 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012426 Rosetta Predictions human pricing
NM_001106187 Rosetta Predictions rat pricing
NM_133953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022583 predicted 1040
2 SASI_Hs01_00022584 predicted 1771
3 SASI_Hs01_00022585 predicted 1777
4 SASI_Hs01_00022586 predicted 796
5 SASI_Hs01_00022587 predicted 2251
6 SASI_Hs01_00022588 predicted 992
7 SASI_Hs01_00022589 predicted 2328
8 SASI_Hs01_00022590 predicted 1077
9 SASI_Hs02_00344309 predicted 1108
10 SASI_Hs02_00344310 predicted 1726
11 SASI_Hs01_00022582 predicted 3690
12 SASI_Hs01_00022591 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216488 predicted 3127
2 SASI_Rn02_00216489 predicted 3689
3 SASI_Rn02_00216490 predicted 2838
4 SASI_Rn02_00216491 predicted 3311
5 SASI_Rn02_00216492 predicted 2767
6 SASI_Rn02_00216493 predicted 3168
7 SASI_Rn02_00216494 predicted 3375
8 SASI_Rn02_00216495 predicted 3518
9 SASI_Rn02_00216496 predicted 3788
10 SASI_Rn02_00216497 predicted 3223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173969 predicted 3682
2 SASI_Mm02_00339062 predicted 1067
3 SASI_Mm01_00173970 predicted 395
4 SASI_Mm01_00173971 predicted 689
5 SASI_Mm01_00173972 predicted 3237
6 SASI_Mm01_00173973 predicted 3139
7 SASI_Mm01_00173974 predicted 378
8 SASI_Mm01_00173975 predicted 3918
9 SASI_Mm01_00173976 predicted 3069
10 SASI_Mm02_00339063 predicted 3127
11 SASI_Mm01_00173968 predicted 360
12 SASI_Mm01_00173977 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133953
VALIDATED
SF3B3 MISSION shRNA Bacterial Glycerol Stock
splicing factor 3b, subunit 3, 130kDa
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-431s1c1
Sequence:CCGGGCCGGATTGTTATCTTGGAATCTCGAGATTCCAAGATAACAATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133953.2-3926s21c1
Sequence:CCGGGCAGAAGTGATGTGGTATTTACTCGAGTAAATACCACATCACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-1226s1c1
Sequence:CCGGCGTCAGAATTTGGAAATCATTCTCGAGAATGATTTCCAAATTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133953.1-3907s1c1
Sequence:CCGGGCAGAAGTGATGTGGTATTTACTCGAGTAAATACCACATCACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133953.1-562s1c1
Sequence:CCGGGCTGTTATGATTAGTGCAATTCTCGAGAATTGCACTAATCATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-3316s1c1
Sequence:CCGGGCAGACAAGTTTGGCAACATTCTCGAGAATGTTGCCAAACTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-942s21c1
Sequence:CCGGTAATCTGCTCTGAGAATTATACTCGAGTATAATTCTCAGAGCAGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-3128s21c1
Sequence:CCGGCTTCGAAAGTGTGAGAATAAGCTCGAGCTTATTCTCACACTTTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133953.2-381s21c1
Sequence:CCGGTCCGGTCACTTATGGCGTTTACTCGAGTAAACGCCATAAGTGACCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-1165s21c1
Sequence:CCGGCGAGATCCGCCTCAAGTATTTCTCGAGAAATACTTGAGGCGGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133953.2-581s21c1
Sequence:CCGGGCTGTTATGATTAGTGCAATTCTCGAGAATTGCACTAATCATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133953
VALIDATED
SF3B3 MISSION shRNA shRNA Plasmid DNA
splicing factor 3b, subunit 3, 130kDa
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-431s1c1
Sequence:CCGGGCCGGATTGTTATCTTGGAATCTCGAGATTCCAAGATAACAATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133953.2-3926s21c1
Sequence:CCGGGCAGAAGTGATGTGGTATTTACTCGAGTAAATACCACATCACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-1226s1c1
Sequence:CCGGCGTCAGAATTTGGAAATCATTCTCGAGAATGATTTCCAAATTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133953.1-3907s1c1
Sequence:CCGGGCAGAAGTGATGTGGTATTTACTCGAGTAAATACCACATCACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133953.1-562s1c1
Sequence:CCGGGCTGTTATGATTAGTGCAATTCTCGAGAATTGCACTAATCATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-3316s1c1
Sequence:CCGGGCAGACAAGTTTGGCAACATTCTCGAGAATGTTGCCAAACTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-942s21c1
Sequence:CCGGTAATCTGCTCTGAGAATTATACTCGAGTATAATTCTCAGAGCAGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-3128s21c1
Sequence:CCGGCTTCGAAAGTGTGAGAATAAGCTCGAGCTTATTCTCACACTTTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133953.2-381s21c1
Sequence:CCGGTCCGGTCACTTATGGCGTTTACTCGAGTAAACGCCATAAGTGACCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-1165s21c1
Sequence:CCGGCGAGATCCGCCTCAAGTATTTCTCGAGAAATACTTGAGGCGGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133953.2-581s21c1
Sequence:CCGGGCTGTTATGATTAGTGCAATTCTCGAGAATTGCACTAATCATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133953
VALIDATED
SF3B3 MISSION shRNA Lentiviral Transduction Particles
splicing factor 3b, subunit 3, 130kDa
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-431s1c1
Sequence:CCGGGCCGGATTGTTATCTTGGAATCTCGAGATTCCAAGATAACAATCCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133953.2-3926s21c1
Sequence:CCGGGCAGAAGTGATGTGGTATTTACTCGAGTAAATACCACATCACTTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-1226s1c1
Sequence:CCGGCGTCAGAATTTGGAAATCATTCTCGAGAATGATTTCCAAATTCTGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133953.1-3907s1c1
Sequence:CCGGGCAGAAGTGATGTGGTATTTACTCGAGTAAATACCACATCACTTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133953.1-562s1c1
Sequence:CCGGGCTGTTATGATTAGTGCAATTCTCGAGAATTGCACTAATCATAACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000109222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133953.1-3316s1c1
Sequence:CCGGGCAGACAAGTTTGGCAACATTCTCGAGAATGTTGCCAAACTTGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-942s21c1
Sequence:CCGGTAATCTGCTCTGAGAATTATACTCGAGTATAATTCTCAGAGCAGATTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-3128s21c1
Sequence:CCGGCTTCGAAAGTGTGAGAATAAGCTCGAGCTTATTCTCACACTTTCGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133953.2-381s21c1
Sequence:CCGGTCCGGTCACTTATGGCGTTTACTCGAGTAAACGCCATAAGTGACCGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133953.2-1165s21c1
Sequence:CCGGCGAGATCCGCCTCAAGTATTTCTCGAGAAATACTTGAGGCGGATCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133953.2-581s21c1
Sequence:CCGGGCTGTTATGATTAGTGCAATTCTCGAGAATTGCACTAATCATAACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012426
VALIDATED
SF3B3 MISSION shRNA Bacterial Glycerol Stock
splicing factor 3b, subunit 3, 130kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-712s21c1
Sequence:CCGGGTTGGAGTAGATGTCGGATTTCTCGAGAAATCCGACATCTACTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-2577s21c1
Sequence:CCGGTGAGAGTAACAACCTTATTATCTCGAGATAATAAGGTTGTTACTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-3898s1c1
Sequence:CCGGAGGAGGGTGACTGGATAATTACTCGAGTAATTATCCAGTCACCCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-1103s1c1
Sequence:CCGGAGACAGATGAAGATATGGTTACTCGAGTAACCATATCTTCATCTGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-2369s1c1
Sequence:CCGGCACTGGAATTTGCATCGGGTTCTCGAGAACCCGATGCAAATTCCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-3334s1c1
Sequence:CCGGCCTAACACCAATGATGAAGTACTCGAGTACTTCATCATTGGTGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012426.x-667s1c1
Sequence:CCGGGTTGGAGTAGATGTCGGATTTCTCGAGAAATCCGACATCTACTCCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-3185s21c1
Sequence:CCGGCTATCGGACATAGGGTAATTGCTCGAGCAATTACCCTATGTCCGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012426.3-1148s21c1
Sequence:CCGGAGACAGATGAAGATATGGTTACTCGAGTAACCATATCTTCATCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-3943s21c1
Sequence:CCGGAGGAGGGTGACTGGATAATTACTCGAGTAATTATCCAGTCACCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.4-3194s21c1
Sequence:CCGGACTATCGGACATAGGGTAATTCTCGAGAATTACCCTATGTCCGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012426
VALIDATED
SF3B3 MISSION shRNA shRNA Plasmid DNA
splicing factor 3b, subunit 3, 130kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-712s21c1
Sequence:CCGGGTTGGAGTAGATGTCGGATTTCTCGAGAAATCCGACATCTACTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-2577s21c1
Sequence:CCGGTGAGAGTAACAACCTTATTATCTCGAGATAATAAGGTTGTTACTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-3898s1c1
Sequence:CCGGAGGAGGGTGACTGGATAATTACTCGAGTAATTATCCAGTCACCCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-1103s1c1
Sequence:CCGGAGACAGATGAAGATATGGTTACTCGAGTAACCATATCTTCATCTGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-2369s1c1
Sequence:CCGGCACTGGAATTTGCATCGGGTTCTCGAGAACCCGATGCAAATTCCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-3334s1c1
Sequence:CCGGCCTAACACCAATGATGAAGTACTCGAGTACTTCATCATTGGTGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012426.x-667s1c1
Sequence:CCGGGTTGGAGTAGATGTCGGATTTCTCGAGAAATCCGACATCTACTCCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-3185s21c1
Sequence:CCGGCTATCGGACATAGGGTAATTGCTCGAGCAATTACCCTATGTCCGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012426.3-1148s21c1
Sequence:CCGGAGACAGATGAAGATATGGTTACTCGAGTAACCATATCTTCATCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-3943s21c1
Sequence:CCGGAGGAGGGTGACTGGATAATTACTCGAGTAATTATCCAGTCACCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.4-3194s21c1
Sequence:CCGGACTATCGGACATAGGGTAATTCTCGAGAATTACCCTATGTCCGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012426
VALIDATED
SF3B3 MISSION shRNA Lentiviral Transduction Particles
splicing factor 3b, subunit 3, 130kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-712s21c1
Sequence:CCGGGTTGGAGTAGATGTCGGATTTCTCGAGAAATCCGACATCTACTCCAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-2577s21c1
Sequence:CCGGTGAGAGTAACAACCTTATTATCTCGAGATAATAAGGTTGTTACTCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-3898s1c1
Sequence:CCGGAGGAGGGTGACTGGATAATTACTCGAGTAATTATCCAGTCACCCTCCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-1103s1c1
Sequence:CCGGAGACAGATGAAGATATGGTTACTCGAGTAACCATATCTTCATCTGTCTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-2369s1c1
Sequence:CCGGCACTGGAATTTGCATCGGGTTCTCGAGAACCCGATGCAAATTCCAGTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012426.x-3334s1c1
Sequence:CCGGCCTAACACCAATGATGAAGTACTCGAGTACTTCATCATTGGTGTTAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000000073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012426.x-667s1c1
Sequence:CCGGGTTGGAGTAGATGTCGGATTTCTCGAGAAATCCGACATCTACTCCAACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-3185s21c1
Sequence:CCGGCTATCGGACATAGGGTAATTGCTCGAGCAATTACCCTATGTCCGATAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012426.3-1148s21c1
Sequence:CCGGAGACAGATGAAGATATGGTTACTCGAGTAACCATATCTTCATCTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.3-3943s21c1
Sequence:CCGGAGGAGGGTGACTGGATAATTACTCGAGTAATTATCCAGTCACCCTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012426.4-3194s21c1
Sequence:CCGGACTATCGGACATAGGGTAATTCTCGAGAATTACCCTATGTCCGATAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???