EMAIL THIS PAGE TO A FRIEND

SFI1

Sfi1 homolog, spindle assembly associated (yeast)

76 Gene Product Result for
Synonyms: PISD hSfi1p
Gene ID:
Mouse(78887) Sfi1 homolog, spindle assembly associated (yeast)
Rat(305467) Sfi1 homolog, spindle assembly associated (yeast)
Zebrafish(560147) Sfi1 homolog, spindle assembly associated (yeast)
chicken(427706) Sfi1 homolog, spindle assembly associated (yeast)
domestic cat(101095861) Sfi1 homolog, spindle assembly associated (yeast)
dog(486367) Sfi1 homolog, spindle assembly associated (yeast)
domestic guinea pig(100720098) Sfi1 homolog, spindle assembly associated (yeast)
naked mole-rat(101702044) Sfi1 homolog, spindle assembly associated (yeast)
Domestic Rabbit(100338522) Sfi1 homolog, spindle assembly associated (yeast)
cow(100138159) Sfi1 homolog, spindle assembly associated (yeast)
sheep(101103925) Sfi1 homolog, spindle assembly associated (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149131 MISSION® esiRNA esiRNA human SFI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007467 Rosetta Predictions human pricing
NM_014775 Rosetta Predictions human pricing
XM_001063601 Rosetta Predictions rat pricing
XM_223587 Rosetta Predictions rat pricing
NM_030207 Rosetta Predictions mouse pricing
XM_906423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084234 predicted 1020
2 SASI_Hs01_00084236 predicted 738
3 SASI_Hs02_00305306 predicted 521
4 SASI_Hs01_00084237 predicted 1006
5 SASI_Hs01_00084238 predicted 2514
6 SASI_Hs01_00084239 predicted 830
7 SASI_Hs01_00084240 predicted 801
8 SASI_Hs01_00084241 predicted 463
9 SASI_Hs01_00084242 predicted 1037
10 SASI_Hs01_00084243 predicted 567
11 SASI_Hs01_00084235 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031049 predicted 1029
2 SASI_Hs01_00031051 predicted 742
3 SASI_Hs02_00346268 predicted 518
4 SASI_Hs01_00031052 predicted 1012
5 SASI_Hs01_00031053 predicted 2422
6 SASI_Hs01_00031054 predicted 830
7 SASI_Hs01_00031055 predicted 809
8 SASI_Hs01_00031056 predicted 464
9 SASI_Hs01_00031057 predicted 1039
10 SASI_Hs01_00031058 predicted 566
11 SASI_Hs01_00031050 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307777 predicted 2919
2 SASI_Rn02_00307778 predicted 3807
3 SASI_Rn02_00307779 predicted 2252
4 SASI_Rn02_00307780 predicted 3622
5 SASI_Rn02_00307781 predicted 853
6 SASI_Rn02_00307782 predicted 1607
7 SASI_Rn02_00307783 predicted 3445
8 SASI_Rn02_00307784 predicted 921
9 SASI_Rn02_00307785 predicted 270
10 SASI_Rn02_00307786 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381527 predicted 2923
2 SASI_Rn02_00381528 predicted 3811
3 SASI_Rn02_00381529 predicted 2247
4 SASI_Rn02_00381530 predicted 3627
5 SASI_Rn02_00381531 predicted 856
6 SASI_Rn02_00381532 predicted 1606
7 SASI_Rn02_00381533 predicted 3443
8 SASI_Rn02_00381534 predicted 918
9 SASI_Rn02_00381535 predicted 267
10 SASI_Rn02_00381536 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336627 predicted 2311
2 SASI_Mm02_00336628 predicted 1033
3 SASI_Mm02_00336629 predicted 365
4 SASI_Mm02_00336630 predicted 377
5 SASI_Mm02_00336631 predicted 1066
6 SASI_Mm02_00336632 predicted 391
7 SASI_Mm02_00336633 predicted 1704
8 SASI_Mm02_00336634 predicted 3528
9 SASI_Mm02_00336635 predicted 567
10 SASI_Mm02_00336636 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284940 predicted 915
2 SASI_Mm01_00284941 predicted 1882
3 SASI_Mm01_00284942 predicted 2067
4 SASI_Mm01_00284943 predicted 2001
5 SASI_Mm01_00284944 predicted 905
6 SASI_Mm01_00284945 predicted 999
7 SASI_Mm01_00284946 predicted 912
8 SASI_Mm01_00284947 predicted 1789
9 SASI_Mm01_00284948 predicted 1936
10 SASI_Mm01_00284949 predicted 999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014775
VALIDATED
SFI1 MISSION shRNA Bacterial Glycerol Stock
Sfi1 homolog, spindle assembly associated (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-1849s21c1
Sequence:CCGGACATTAGAGAAGCAAGTATTTCTCGAGAAATACTTGCTTCTCTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014775.2-747s1c1
Sequence:CCGGGCGATTACTACGGAAGGTCTTCTCGAGAAGACCTTCCGTAGTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-664s21c1
Sequence:CCGGGTGGCCAGAAAGTTCTTATATCTCGAGATATAAGAACTTTCTGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-1029s21c1
Sequence:CCGGGGAGTTTAGGCAACGGATTATCTCGAGATAATCCGTTGCCTAAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-1945s1c1
Sequence:CCGGCGACAGCTTCTGTATAGGTCTCTCGAGAGACCTATACAGAAGCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-829s21c1
Sequence:CCGGGACTGTCACTACAGGTATTACCTCGAGGTAATACCTGTAGTGACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-1654s1c1
Sequence:CCGGCTGCTGTGCAAATGTATCGAACTCGAGTTCGATACATTTGCACAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-574s1c1
Sequence:CCGGGAGTTACCTAGTACCAGTCATCTCGAGATGACTGGTACTAGGTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-2415s21c1
Sequence:CCGGCTTTCAAGCAAGTACTCATTACTCGAGTAATGAGTACTTGCTTGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014775
VALIDATED
SFI1 MISSION shRNA shRNA Plasmid DNA
Sfi1 homolog, spindle assembly associated (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-1849s21c1
Sequence:CCGGACATTAGAGAAGCAAGTATTTCTCGAGAAATACTTGCTTCTCTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014775.2-747s1c1
Sequence:CCGGGCGATTACTACGGAAGGTCTTCTCGAGAAGACCTTCCGTAGTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-664s21c1
Sequence:CCGGGTGGCCAGAAAGTTCTTATATCTCGAGATATAAGAACTTTCTGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-1029s21c1
Sequence:CCGGGGAGTTTAGGCAACGGATTATCTCGAGATAATCCGTTGCCTAAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-1945s1c1
Sequence:CCGGCGACAGCTTCTGTATAGGTCTCTCGAGAGACCTATACAGAAGCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-829s21c1
Sequence:CCGGGACTGTCACTACAGGTATTACCTCGAGGTAATACCTGTAGTGACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-1654s1c1
Sequence:CCGGCTGCTGTGCAAATGTATCGAACTCGAGTTCGATACATTTGCACAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-574s1c1
Sequence:CCGGGAGTTACCTAGTACCAGTCATCTCGAGATGACTGGTACTAGGTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-2415s21c1
Sequence:CCGGCTTTCAAGCAAGTACTCATTACTCGAGTAATGAGTACTTGCTTGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014775
VALIDATED
SFI1 MISSION shRNA Lentiviral Transduction Particles
Sfi1 homolog, spindle assembly associated (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-1849s21c1
Sequence:CCGGACATTAGAGAAGCAAGTATTTCTCGAGAAATACTTGCTTCTCTAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014775.2-747s1c1
Sequence:CCGGGCGATTACTACGGAAGGTCTTCTCGAGAAGACCTTCCGTAGTAATCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-664s21c1
Sequence:CCGGGTGGCCAGAAAGTTCTTATATCTCGAGATATAAGAACTTTCTGGCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-1029s21c1
Sequence:CCGGGGAGTTTAGGCAACGGATTATCTCGAGATAATCCGTTGCCTAAACTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-1945s1c1
Sequence:CCGGCGACAGCTTCTGTATAGGTCTCTCGAGAGACCTATACAGAAGCTGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-829s21c1
Sequence:CCGGGACTGTCACTACAGGTATTACCTCGAGGTAATACCTGTAGTGACAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-1654s1c1
Sequence:CCGGCTGCTGTGCAAATGTATCGAACTCGAGTTCGATACATTTGCACAGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014775.2-574s1c1
Sequence:CCGGGAGTTACCTAGTACCAGTCATCTCGAGATGACTGGTACTAGGTAACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014775.2-2415s21c1
Sequence:CCGGCTTTCAAGCAAGTACTCATTACTCGAGTAATGAGTACTTGCTTGAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030207
SFI1 MISSION shRNA Bacterial Glycerol Stock
Sfi1 homolog, spindle assembly associated (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-1674s21c1
Sequence:CCGGACATTAGAGAAGCAAGTATTTCTCGAGAAATACTTGCTTCTCTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-1547s21c1
Sequence:CCGGGGCCAGAGCAGATGGTCATTTCTCGAGAAATGACCATCTGCTCTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-695s21c1
Sequence:CCGGCTGGAAGTCCTGGTTGATATACTCGAGTATATCAACCAGGACTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-2304s21c1
Sequence:CCGGGTTACTTCAGTGCAGATATATCTCGAGATATATCTGCACTGAAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-636s21c1
Sequence:CCGGATGAGGAAGAGGTTCCGAATACTCGAGTATTCGGAACCTCTTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030207
SFI1 MISSION shRNA shRNA Plasmid DNA
Sfi1 homolog, spindle assembly associated (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-1674s21c1
Sequence:CCGGACATTAGAGAAGCAAGTATTTCTCGAGAAATACTTGCTTCTCTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-1547s21c1
Sequence:CCGGGGCCAGAGCAGATGGTCATTTCTCGAGAAATGACCATCTGCTCTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-695s21c1
Sequence:CCGGCTGGAAGTCCTGGTTGATATACTCGAGTATATCAACCAGGACTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-2304s21c1
Sequence:CCGGGTTACTTCAGTGCAGATATATCTCGAGATATATCTGCACTGAAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-636s21c1
Sequence:CCGGATGAGGAAGAGGTTCCGAATACTCGAGTATTCGGAACCTCTTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030207
SFI1 MISSION shRNA Lentiviral Transduction Particles
Sfi1 homolog, spindle assembly associated (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-1674s21c1
Sequence:CCGGACATTAGAGAAGCAAGTATTTCTCGAGAAATACTTGCTTCTCTAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-1547s21c1
Sequence:CCGGGGCCAGAGCAGATGGTCATTTCTCGAGAAATGACCATCTGCTCTGGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-695s21c1
Sequence:CCGGCTGGAAGTCCTGGTTGATATACTCGAGTATATCAACCAGGACTTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-2304s21c1
Sequence:CCGGGTTACTTCAGTGCAGATATATCTCGAGATATATCTGCACTGAAGTAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030207.2-636s21c1
Sequence:CCGGATGAGGAAGAGGTTCCGAATACTCGAGTATTCGGAACCTCTTCCTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)