EMAIL THIS PAGE TO A FRIEND

SFRP4

secreted frizzled-related protein 4

83 Gene Product Result for
Synonyms: FRP-4 FRPHE sFRP-4
Gene ID:
Human(6424) Summary: Secreted frizzled-related protein 4 (SFRP4) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. The expression of SFRP4 in ventricular myocardium correlates with apoptosis related gene expression. [provided by RefSeq, Jul 2008]
Mouse(20379) secreted frizzled-related protein 4
Rat(89803) secreted frizzled-related protein 4
domestic guinea pig(100716916) secreted frizzled-related protein 4
naked mole-rat(101714800) secreted frizzled-related protein 4
cow(518004) secreted frizzled-related protein 4
sheep(101107858) secreted frizzled-related protein 4
chicken(420732) secreted frizzled-related protein 4
dog(483258) secreted frizzled-related protein 4
domestic cat(101100795) secreted frizzled-related protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003014 Rosetta Predictions human pricing
NM_053544 Rosetta Predictions rat pricing
NM_016687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143250 predicted 1420
2 SASI_Hs01_00143252 predicted 1146
3 SASI_Hs01_00143251 predicted 849
4 SASI_Hs01_00143253 predicted 1438
5 SASI_Hs01_00143254 predicted 827
6 SASI_Hs01_00143255 predicted 1212
7 SASI_Hs02_00334908 predicted 1271
8 SASI_Hs01_00143256 predicted 1396
9 SASI_Hs01_00143258 predicted 1046
10 SASI_Hs02_00334909 predicted 1170
11 SASI_Hs01_00143257 predicted 1535
12 SASI_Hs01_00143259 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038937 predicted 1128
2 SASI_Rn01_00038938 predicted 578
3 SASI_Rn01_00038939 predicted 558
4 SASI_Rn01_00038942 predicted 1245
5 SASI_Rn01_00038943 predicted 1141
6 SASI_Rn01_00038944 predicted 495
7 SASI_Rn01_00038945 predicted 478
8 SASI_Rn01_00038946 predicted 1072
9 SASI_Rn02_00266165 predicted 1409
10 SASI_Rn02_00266166 predicted 583
11 SASI_Rn01_00038940 predicted 1162
12 SASI_Rn01_00038941 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086942 predicted 911
2 SASI_Mm01_00086943 predicted 660
3 SASI_Mm01_00086944 predicted 762
4 SASI_Mm01_00086945 predicted 1027
5 SASI_Mm01_00086946 predicted 1387
6 SASI_Mm01_00086947 predicted 1176
7 SASI_Mm01_00086948 predicted 1316
8 SASI_Mm01_00086949 predicted 726
9 SASI_Mm01_00086950 predicted 1253
10 SASI_Mm01_00086951 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003014
SFRP4 MISSION shRNA Bacterial Glycerol Stock
secreted frizzled-related protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-909s21c1
Sequence:CCGGCCCGATCGGTGCAAGTGTAAACTCGAGTTTACACTTGCACCGATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-1081s21c1
Sequence:CCGGGAACTCAAGTCCCGCTCATTACTCGAGTAATGAGCGGGACTTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-1028s21c1
Sequence:CCGGCACAACGGTGGTGGATGTAAACTCGAGTTTACATCCACCACCGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-730s1c1
Sequence:CCGGCCTCTTGATGTTGACTGTAAACTCGAGTTTACAGTCAACATCAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003014.2-1596s1c1
Sequence:CCGGCGACCTAATATGTGCATTGTACTCGAGTACAATGCACATATTAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-676s1c1
Sequence:CCGGCCGGAGGATGTTAAGTGGATACTCGAGTATCCACTTAACATCCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-1248s1c1
Sequence:CCGGCCAGAAGAGAACAAACCCGAACTCGAGTTCGGGTTTGTTCTCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-1213s1c1
Sequence:CCGGGCCAGTCCCAAGAAGAACATTCTCGAGAATGTTCTTCTTGGGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003014
SFRP4 MISSION shRNA shRNA Plasmid DNA
secreted frizzled-related protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-909s21c1
Sequence:CCGGCCCGATCGGTGCAAGTGTAAACTCGAGTTTACACTTGCACCGATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-1081s21c1
Sequence:CCGGGAACTCAAGTCCCGCTCATTACTCGAGTAATGAGCGGGACTTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-1028s21c1
Sequence:CCGGCACAACGGTGGTGGATGTAAACTCGAGTTTACATCCACCACCGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-730s1c1
Sequence:CCGGCCTCTTGATGTTGACTGTAAACTCGAGTTTACAGTCAACATCAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003014.2-1596s1c1
Sequence:CCGGCGACCTAATATGTGCATTGTACTCGAGTACAATGCACATATTAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-676s1c1
Sequence:CCGGCCGGAGGATGTTAAGTGGATACTCGAGTATCCACTTAACATCCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-1248s1c1
Sequence:CCGGCCAGAAGAGAACAAACCCGAACTCGAGTTCGGGTTTGTTCTCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-1213s1c1
Sequence:CCGGGCCAGTCCCAAGAAGAACATTCTCGAGAATGTTCTTCTTGGGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003014
SFRP4 MISSION shRNA Lentiviral Transduction Particles
secreted frizzled-related protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-909s21c1
Sequence:CCGGCCCGATCGGTGCAAGTGTAAACTCGAGTTTACACTTGCACCGATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-1081s21c1
Sequence:CCGGGAACTCAAGTCCCGCTCATTACTCGAGTAATGAGCGGGACTTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003014.3-1028s21c1
Sequence:CCGGCACAACGGTGGTGGATGTAAACTCGAGTTTACATCCACCACCGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-730s1c1
Sequence:CCGGCCTCTTGATGTTGACTGTAAACTCGAGTTTACAGTCAACATCAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003014.2-1596s1c1
Sequence:CCGGCGACCTAATATGTGCATTGTACTCGAGTACAATGCACATATTAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-676s1c1
Sequence:CCGGCCGGAGGATGTTAAGTGGATACTCGAGTATCCACTTAACATCCTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-1248s1c1
Sequence:CCGGCCAGAAGAGAACAAACCCGAACTCGAGTTCGGGTTTGTTCTCTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003014.2-1213s1c1
Sequence:CCGGGCCAGTCCCAAGAAGAACATTCTCGAGAATGTTCTTCTTGGGACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016687
VALIDATED
SFRP4 MISSION shRNA Bacterial Glycerol Stock
secreted frizzled-related protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-658s1c1
Sequence:CCGGCCGGTCTATGACCGTGGAGTTCTCGAGAACTCCACGGTCATAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-832s1c1
Sequence:CCGGCTGGCAACATACCTGAGCAAACTCGAGTTTGCTCAGGTATGTTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016687.1-1260s1c1
Sequence:CCGGCAGTCCTAAGAAGAACATCAACTCGAGTTGATGTTCTTCTTAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-742s1c1
Sequence:CCGGCCAGATATGATGGTGCAAGAACTCGAGTTCTTGCACCATCATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-1057s1c1
Sequence:CCGGCGTTCAAGGATGATGCTTCTTCTCGAGAAGAAGCATCATCCTTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016687
VALIDATED
SFRP4 MISSION shRNA shRNA Plasmid DNA
secreted frizzled-related protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-658s1c1
Sequence:CCGGCCGGTCTATGACCGTGGAGTTCTCGAGAACTCCACGGTCATAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-832s1c1
Sequence:CCGGCTGGCAACATACCTGAGCAAACTCGAGTTTGCTCAGGTATGTTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016687.1-1260s1c1
Sequence:CCGGCAGTCCTAAGAAGAACATCAACTCGAGTTGATGTTCTTCTTAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-742s1c1
Sequence:CCGGCCAGATATGATGGTGCAAGAACTCGAGTTCTTGCACCATCATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-1057s1c1
Sequence:CCGGCGTTCAAGGATGATGCTTCTTCTCGAGAAGAAGCATCATCCTTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016687
VALIDATED
SFRP4 MISSION shRNA Lentiviral Transduction Particles
secreted frizzled-related protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-658s1c1
Sequence:CCGGCCGGTCTATGACCGTGGAGTTCTCGAGAACTCCACGGTCATAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-832s1c1
Sequence:CCGGCTGGCAACATACCTGAGCAAACTCGAGTTTGCTCAGGTATGTTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016687.1-1260s1c1
Sequence:CCGGCAGTCCTAAGAAGAACATCAACTCGAGTTGATGTTCTTCTTAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-742s1c1
Sequence:CCGGCCAGATATGATGGTGCAAGAACTCGAGTTCTTGCACCATCATATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016687.1-1057s1c1
Sequence:CCGGCGTTCAAGGATGATGCTTCTTCTCGAGAAGAAGCATCATCCTTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)