EMAIL THIS PAGE TO A FRIEND

SFSWAP

splicing factor, suppressor of white-apricot homolog (Drosophila)

65 Gene Product Result for
Synonyms: SFRS8 SWAP
UniProtKB ID: Q12872, B2RN45, B7ZM97, F5H6B8, Q6PJF7
Gene ID:
Human(6433) Summary: This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
Mouse(231769) splicing factor, suppressor of white-apricot homolog (Drosophila)
Rat(304431) splicing factor, suppressor of white-apricot homolog (Drosophila)
Zebrafish(394143) splicing factor, suppressor of white-apricot homolog (Drosophila)
chicken(416802) splicing factor, suppressor of white-apricot homolog (Drosophila)
dog(477438) splicing factor, suppressor of white-apricot homolog (Drosophila)
Horse(100062382) splicing factor, suppressor of white-apricot homolog (Drosophila)
domestic cat(101094454) splicing factor, suppressor of white-apricot homolog (Drosophila)
cow(512326) splicing factor, suppressor of white-apricot homolog (Drosophila)
sheep(101113101) splicing factor, suppressor of white-apricot homolog (Drosophila)
domestic guinea pig(100716402) splicing factor, suppressor of white-apricot homolog (Drosophila)
naked mole-rat(101713204) splicing factor, suppressor of white-apricot homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004592 Rosetta Predictions human pricing
NM_001034924 Rosetta Predictions rat pricing
NM_001035259 Rosetta Predictions mouse pricing
NM_172276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104183 predicted 1931
2 SASI_Hs01_00104184 predicted 1972
3 SASI_Hs01_00104186 predicted 396
4 SASI_Hs01_00104187 predicted 457
5 SASI_Hs01_00104188 predicted 598
6 SASI_Hs02_00337955 predicted 1855
7 SASI_Hs01_00104189 predicted 338
8 SASI_Hs01_00104190 predicted 1236
9 SASI_Hs01_00104191 predicted 349
10 SASI_Hs01_00104192 predicted 589
11 SASI_Hs01_00104185 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204063 predicted 1635
2 SASI_Rn02_00204064 predicted 1689
3 SASI_Rn01_00082358 predicted 1436
4 SASI_Rn01_00082360 predicted 1153
5 SASI_Rn01_00082361 predicted 2761
6 SASI_Rn02_00204065 predicted 1607
7 SASI_Rn01_00082362 predicted 499
8 SASI_Rn02_00204066 predicted 744
9 SASI_Rn01_00082363 predicted 1489
10 SASI_Rn01_00082365 predicted 2567
11 SASI_Rn01_00082357 predicted 1458
12 SASI_Rn01_00082359 predicted 1538
13 SASI_Rn01_00082364 predicted 723
14 SASI_Rn01_00082366 predicted 2743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072680 predicted 1246
2 SASI_Mm01_00072681 predicted 2023
3 SASI_Mm01_00072682 predicted 2819
4 SASI_Mm01_00072683 predicted 1540
5 SASI_Mm01_00072684 predicted 2194
6 SASI_Mm01_00072685 predicted 2528
7 SASI_Mm01_00072686 predicted 2386
8 SASI_Mm01_00072687 predicted 1126
9 SASI_Mm01_00072688 predicted 1631
10 SASI_Mm01_00072689 predicted 2049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036155 predicted 1541
2 SASI_Mm01_00036156 predicted 425
3 SASI_Mm01_00036157 predicted 1531
4 SASI_Mm01_00036158 predicted 1248
5 SASI_Mm01_00036159 predicted 1204
6 SASI_Mm01_00036160 predicted 1628
7 SASI_Mm01_00036161 predicted 1041
8 SASI_Mm01_00036162 predicted 1579
9 SASI_Mm01_00036163 predicted 469
10 SASI_Mm01_00036164 predicted 1697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004592
VALIDATED
SFSWAP MISSION shRNA Bacterial Glycerol Stock
splicing factor, suppressor of white-apricot homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-1616s1c1
Sequence:CCGGGCACCAGTATAATGCTTATTACTCGAGTAATAAGCATTATACTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-465s1c1
Sequence:CCGGCTGTGTGATGAAGAGAGGTATCTCGAGATACCTCTCTTCATCACACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-2382s1c1
Sequence:CCGGCCACCGAGAGAAGAAGAGAAACTCGAGTTTCTCTTCTTCTCTCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004592.2-2075s1c1
Sequence:CCGGGCTAGAAGCAAAGCAAGCAAACTCGAGTTTGCTTGCTTTGCTTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-2328s1c1
Sequence:CCGGCTGCCTACTTTAGAAGTTAAACTCGAGTTTAACTTCTAAAGTAGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1296s21c1
Sequence:CCGGGGAATCGACGTGACTACTTACCTCGAGGTAAGTAGTCACGTCGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1223s21c1
Sequence:CCGGGACCGTGGCAGCCATGTATTACTCGAGTAATACATGGCTGCCACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-593s21c1
Sequence:CCGGCACTTACGGTAGCGACTATTACTCGAGTAATAGTCGCTACCGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1574s21c1
Sequence:CCGGTCGTGCCAAGAATGATCAAAGCTCGAGCTTTGATCATTCTTGGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-2075s21c1
Sequence:CCGGGCTAGAAGCAAAGCAAGCAAACTCGAGTTTGCTTGCTTTGCTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004592
VALIDATED
SFSWAP MISSION shRNA shRNA Plasmid DNA
splicing factor, suppressor of white-apricot homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-1616s1c1
Sequence:CCGGGCACCAGTATAATGCTTATTACTCGAGTAATAAGCATTATACTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-465s1c1
Sequence:CCGGCTGTGTGATGAAGAGAGGTATCTCGAGATACCTCTCTTCATCACACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-2382s1c1
Sequence:CCGGCCACCGAGAGAAGAAGAGAAACTCGAGTTTCTCTTCTTCTCTCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004592.2-2075s1c1
Sequence:CCGGGCTAGAAGCAAAGCAAGCAAACTCGAGTTTGCTTGCTTTGCTTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-2328s1c1
Sequence:CCGGCTGCCTACTTTAGAAGTTAAACTCGAGTTTAACTTCTAAAGTAGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1296s21c1
Sequence:CCGGGGAATCGACGTGACTACTTACCTCGAGGTAAGTAGTCACGTCGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1223s21c1
Sequence:CCGGGACCGTGGCAGCCATGTATTACTCGAGTAATACATGGCTGCCACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-593s21c1
Sequence:CCGGCACTTACGGTAGCGACTATTACTCGAGTAATAGTCGCTACCGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1574s21c1
Sequence:CCGGTCGTGCCAAGAATGATCAAAGCTCGAGCTTTGATCATTCTTGGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-2075s21c1
Sequence:CCGGGCTAGAAGCAAAGCAAGCAAACTCGAGTTTGCTTGCTTTGCTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004592
VALIDATED
SFSWAP MISSION shRNA Lentiviral Transduction Particles
splicing factor, suppressor of white-apricot homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-1616s1c1
Sequence:CCGGGCACCAGTATAATGCTTATTACTCGAGTAATAAGCATTATACTGGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-465s1c1
Sequence:CCGGCTGTGTGATGAAGAGAGGTATCTCGAGATACCTCTCTTCATCACACAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-2382s1c1
Sequence:CCGGCCACCGAGAGAAGAAGAGAAACTCGAGTTTCTCTTCTTCTCTCGGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004592.2-2075s1c1
Sequence:CCGGGCTAGAAGCAAAGCAAGCAAACTCGAGTTTGCTTGCTTTGCTTCTAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004592.2-2328s1c1
Sequence:CCGGCTGCCTACTTTAGAAGTTAAACTCGAGTTTAACTTCTAAAGTAGGCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1296s21c1
Sequence:CCGGGGAATCGACGTGACTACTTACCTCGAGGTAAGTAGTCACGTCGATTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000282007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1223s21c1
Sequence:CCGGGACCGTGGCAGCCATGTATTACTCGAGTAATACATGGCTGCCACGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-593s21c1
Sequence:CCGGCACTTACGGTAGCGACTATTACTCGAGTAATAGTCGCTACCGTAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-1574s21c1
Sequence:CCGGTCGTGCCAAGAATGATCAAAGCTCGAGCTTTGATCATTCTTGGCACGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004592.2-2075s21c1
Sequence:CCGGGCTAGAAGCAAAGCAAGCAAACTCGAGTTTGCTTGCTTTGCTTCTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172276
VALIDATED
SFSWAP MISSION shRNA Bacterial Glycerol Stock
splicing factor, suppressor of white-apricot homolog (Drosophila)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-1544s21c1
Sequence:CCGGGTCGCTAGAAACGGCCTTAAACTCGAGTTTAAGGCCGTTTCTAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172276.3-3109s21c1
Sequence:CCGGTGCCGACCTACATGCAGCTATCTCGAGATAGCTGCATGTAGGTCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-958s21c1
Sequence:CCGGGAGCAAGAACGAGGAGAAGAACTCGAGTTCTTCTCCTCGTTCTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-602s21c1
Sequence:CCGGACTTACGGCAGCGACTATTATCTCGAGATAATAGTCGCTGCCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-560s1c1
Sequence:CCGGCAGTGCCATAGGGTTCACTTACTCGAGTAAGTGAACCCTATGGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-447s1c1
Sequence:CCGGCTGTGTGATGAAGAGAGGTATCTCGAGATACCTCTCTTCATCACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-472s21c1
Sequence:CCGGGCTGTGTGATGAAGAGAGGTACTCGAGTACCTCTCTTCATCACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-323s1c1
Sequence:CCGGCAAGATCCTCATCGACAGATACTCGAGTATCTGTCGATGAGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-459s1c1
Sequence:CCGGGAGAGGTATTTAGCCTTGCATCTCGAGATGCAAGGCTAAATACCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-764s1c1
Sequence:CCGGCACAGCCAACTTCGTATGCAACTCGAGTTGCATACGAAGTTGGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-446s1c1
Sequence:CCGGGCTGTGTGATGAAGAGAGGTACTCGAGTACCTCTCTTCATCACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-932s1c1
Sequence:CCGGGAGCAAGAACGAGGAGAAGAACTCGAGTTCTTCTCCTCGTTCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-587s1c1
Sequence:CCGGCGACTATTATGACCCGTCAGACTCGAGTCTGACGGGTCATAATAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.3-2202s1c1
Sequence:CCGGCGTTGTTCTTACAAACCTTAACTCGAGTTAAGGTTTGTAAGAACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172276
VALIDATED
SFSWAP MISSION shRNA shRNA Plasmid DNA
splicing factor, suppressor of white-apricot homolog (Drosophila)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-1544s21c1
Sequence:CCGGGTCGCTAGAAACGGCCTTAAACTCGAGTTTAAGGCCGTTTCTAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172276.3-3109s21c1
Sequence:CCGGTGCCGACCTACATGCAGCTATCTCGAGATAGCTGCATGTAGGTCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-958s21c1
Sequence:CCGGGAGCAAGAACGAGGAGAAGAACTCGAGTTCTTCTCCTCGTTCTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-602s21c1
Sequence:CCGGACTTACGGCAGCGACTATTATCTCGAGATAATAGTCGCTGCCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-560s1c1
Sequence:CCGGCAGTGCCATAGGGTTCACTTACTCGAGTAAGTGAACCCTATGGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-447s1c1
Sequence:CCGGCTGTGTGATGAAGAGAGGTATCTCGAGATACCTCTCTTCATCACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-472s21c1
Sequence:CCGGGCTGTGTGATGAAGAGAGGTACTCGAGTACCTCTCTTCATCACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-323s1c1
Sequence:CCGGCAAGATCCTCATCGACAGATACTCGAGTATCTGTCGATGAGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-459s1c1
Sequence:CCGGGAGAGGTATTTAGCCTTGCATCTCGAGATGCAAGGCTAAATACCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-764s1c1
Sequence:CCGGCACAGCCAACTTCGTATGCAACTCGAGTTGCATACGAAGTTGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-446s1c1
Sequence:CCGGGCTGTGTGATGAAGAGAGGTACTCGAGTACCTCTCTTCATCACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-932s1c1
Sequence:CCGGGAGCAAGAACGAGGAGAAGAACTCGAGTTCTTCTCCTCGTTCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-587s1c1
Sequence:CCGGCGACTATTATGACCCGTCAGACTCGAGTCTGACGGGTCATAATAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.3-2202s1c1
Sequence:CCGGCGTTGTTCTTACAAACCTTAACTCGAGTTAAGGTTTGTAAGAACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172276
VALIDATED
SFSWAP MISSION shRNA Lentiviral Transduction Particles
splicing factor, suppressor of white-apricot homolog (Drosophila)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-1544s21c1
Sequence:CCGGGTCGCTAGAAACGGCCTTAAACTCGAGTTTAAGGCCGTTTCTAGCGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172276.3-3109s21c1
Sequence:CCGGTGCCGACCTACATGCAGCTATCTCGAGATAGCTGCATGTAGGTCGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-958s21c1
Sequence:CCGGGAGCAAGAACGAGGAGAAGAACTCGAGTTCTTCTCCTCGTTCTTGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-602s21c1
Sequence:CCGGACTTACGGCAGCGACTATTATCTCGAGATAATAGTCGCTGCCGTAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-560s1c1
Sequence:CCGGCAGTGCCATAGGGTTCACTTACTCGAGTAAGTGAACCCTATGGCACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-447s1c1
Sequence:CCGGCTGTGTGATGAAGAGAGGTATCTCGAGATACCTCTCTTCATCACACAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000285984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172276.3-472s21c1
Sequence:CCGGGCTGTGTGATGAAGAGAGGTACTCGAGTACCTCTCTTCATCACACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-323s1c1
Sequence:CCGGCAAGATCCTCATCGACAGATACTCGAGTATCTGTCGATGAGGATCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-459s1c1
Sequence:CCGGGAGAGGTATTTAGCCTTGCATCTCGAGATGCAAGGCTAAATACCTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-764s1c1
Sequence:CCGGCACAGCCAACTTCGTATGCAACTCGAGTTGCATACGAAGTTGGCTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-446s1c1
Sequence:CCGGGCTGTGTGATGAAGAGAGGTACTCGAGTACCTCTCTTCATCACACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172276.1-932s1c1
Sequence:CCGGGAGCAAGAACGAGGAGAAGAACTCGAGTTCTTCTCCTCGTTCTTGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.1-587s1c1
Sequence:CCGGCGACTATTATGACCCGTCAGACTCGAGTCTGACGGGTCATAATAGTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172276.3-2202s1c1
Sequence:CCGGCGTTGTTCTTACAAACCTTAACTCGAGTTAAGGTTTGTAAGAACAACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???