EMAIL THIS PAGE TO A FRIEND

SFTPB

surfactant protein B

62 Gene Product Result for
Synonyms: PSP-B SFTB3 SFTP3 SMDP1 SP-B
UniProtKB ID: P07988, Q96R04
Gene ID:
Human(6439) Summary: This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
Mouse(20388) surfactant associated protein B
Rat(192155) surfactant protein B
Horse(100034028) surfactant protein B
domestic cat(101091359) surfactant protein B
dog(100688334) surfactant protein B
cow(507398) surfactant protein B
sheep(443043) surfactant protein B
domestic guinea pig(100379548) surfactant associated protein B
naked mole-rat(101700017) surfactant protein B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0355 AQUA Peptide DPLPD[P]LLDK human pricing
AQ0354 AQUA Peptide FPIPL[P]YCWLCR human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000542 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123801 MISSION® esiRNA esiRNA human SFTPB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000542 Rosetta Predictions human pricing
NM_198843 Rosetta Predictions human pricing
NM_138842 Rosetta Predictions rat pricing
NM_147779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079150 predicted 382
2 SASI_Hs01_00079151 predicted 335
3 SASI_Hs01_00079152 predicted 395
4 SASI_Hs02_00302762 predicted 851
5 SASI_Hs01_00079153 predicted 580
6 SASI_Hs02_00302763 predicted 622
7 SASI_Hs01_00079155 predicted 942
8 SASI_Hs01_00079156 predicted 760
9 SASI_Hs01_00079157 predicted 334
10 SASI_Hs01_00079158 predicted 870
11 SASI_Hs01_00079154 predicted 761
12 SASI_Hs01_00079159 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183982 predicted 392
2 SASI_Hs01_00183983 predicted 334
3 SASI_Hs01_00183984 predicted 395
4 SASI_Hs02_00372350 predicted 852
5 SASI_Hs01_00183985 predicted 580
6 SASI_Hs02_00372351 predicted 631
7 SASI_Hs01_00183987 predicted 943
8 SASI_Hs01_00183988 predicted 761
9 SASI_Hs01_00183989 predicted 336
10 SASI_Hs01_00183990 predicted 869
11 SASI_Hs01_00183986 predicted 763
12 SASI_Hs01_00183991 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038160 predicted 878
2 SASI_Rn01_00038161 predicted 455
3 SASI_Rn01_00038162 predicted 1231
4 SASI_Rn01_00038163 predicted 834
5 SASI_Rn01_00038164 predicted 889
6 SASI_Rn02_00268224 predicted 724
7 SASI_Rn02_00268225 predicted 276
8 SASI_Rn01_00038166 predicted 295
9 SASI_Rn01_00038167 predicted 870
10 SASI_Rn01_00038168 predicted 958
11 SASI_Rn01_00038159 predicted 370
12 SASI_Rn01_00038165 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037193 predicted 432
2 SASI_Mm01_00037194 predicted 629
3 SASI_Mm01_00037195 predicted 1254
4 SASI_Mm01_00037196 predicted 612
5 SASI_Mm01_00037197 predicted 521
6 SASI_Mm01_00037198 predicted 1225
7 SASI_Mm01_00037200 predicted 554
8 SASI_Mm01_00037201 predicted 1299
9 SASI_Mm01_00037202 predicted 1202
10 SASI_Mm02_00342714 predicted 1218
11 SASI_Mm01_00037199 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000542
SFTPB MISSION shRNA Bacterial Glycerol Stock
surfactant protein B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000542.2-1771s1c1
Sequence:CCGGGCTGCTTGAGAGCTATTGCTTCTCGAGAAGCAATAGCTCTCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-640s1c1
Sequence:CCGGGCTCTGATCAAGCGGATCCAACTCGAGTTGGATCCGCTTGATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-384s1c1
Sequence:CCGGCCAGAACCAGACTGACTCAAACTCGAGTTTGAGTCAGTCTGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000542.2-1640s21c1
Sequence:CCGGTAGACATCAGAAATTGTTAAGCTCGAGCTTAACAATTTCTGATGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-342s1c1
Sequence:CCGGCCAAGTGCTTGACGACTACTTCTCGAGAAGTAGTCGTCAAGCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-228s1c1
Sequence:CCGGCGTCCACATCCTTAACAAGATCTCGAGATCTTGTTAAGGATGTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000542.2-1555s21c1
Sequence:CCGGATGCACTCAAAGATTGGATTTCTCGAGAAATCCAATCTTTGAGTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000542.2-585s21c1
Sequence:CCGGGGATCTCTCCGAGCAGCAATTCTCGAGAATTGCTGCTCGGAGAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000542
SFTPB MISSION shRNA shRNA Plasmid DNA
surfactant protein B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000542.2-1771s1c1
Sequence:CCGGGCTGCTTGAGAGCTATTGCTTCTCGAGAAGCAATAGCTCTCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-640s1c1
Sequence:CCGGGCTCTGATCAAGCGGATCCAACTCGAGTTGGATCCGCTTGATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-384s1c1
Sequence:CCGGCCAGAACCAGACTGACTCAAACTCGAGTTTGAGTCAGTCTGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000542.2-1640s21c1
Sequence:CCGGTAGACATCAGAAATTGTTAAGCTCGAGCTTAACAATTTCTGATGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-342s1c1
Sequence:CCGGCCAAGTGCTTGACGACTACTTCTCGAGAAGTAGTCGTCAAGCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-228s1c1
Sequence:CCGGCGTCCACATCCTTAACAAGATCTCGAGATCTTGTTAAGGATGTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000542.2-1555s21c1
Sequence:CCGGATGCACTCAAAGATTGGATTTCTCGAGAAATCCAATCTTTGAGTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000542.2-585s21c1
Sequence:CCGGGGATCTCTCCGAGCAGCAATTCTCGAGAATTGCTGCTCGGAGAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000542
SFTPB MISSION shRNA Lentiviral Transduction Particles
surfactant protein B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000542.2-1771s1c1
Sequence:CCGGGCTGCTTGAGAGCTATTGCTTCTCGAGAAGCAATAGCTCTCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-640s1c1
Sequence:CCGGGCTCTGATCAAGCGGATCCAACTCGAGTTGGATCCGCTTGATCAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-384s1c1
Sequence:CCGGCCAGAACCAGACTGACTCAAACTCGAGTTTGAGTCAGTCTGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000542.2-1640s21c1
Sequence:CCGGTAGACATCAGAAATTGTTAAGCTCGAGCTTAACAATTTCTGATGTCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-342s1c1
Sequence:CCGGCCAAGTGCTTGACGACTACTTCTCGAGAAGTAGTCGTCAAGCACTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000542.2-228s1c1
Sequence:CCGGCGTCCACATCCTTAACAAGATCTCGAGATCTTGTTAAGGATGTGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000542.2-1555s21c1
Sequence:CCGGATGCACTCAAAGATTGGATTTCTCGAGAAATCCAATCTTTGAGTGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000542.2-585s21c1
Sequence:CCGGGGATCTCTCCGAGCAGCAATTCTCGAGAATTGCTGCTCGGAGAGATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147779
SFTPB MISSION shRNA Bacterial Glycerol Stock
surfactant protein B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147779.1-1537s1c1
Sequence:CCGGAGTCTGTATGTCCCAGCTCTACTCGAGTAGAGCTGGGACATACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-1223s1c1
Sequence:CCGGCCATTTCTGCAAGTCTGTGATCTCGAGATCACAGACTTGCAGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-566s1c1
Sequence:CCGGCCTCCTCACAAAGATGACCAACTCGAGTTGGTCATCTTTGTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-612s1c1
Sequence:CCGGCGGAAGTTCCTGGAACAAGAACTCGAGTTCTTGTTCCAGGAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-439s1c1
Sequence:CCGGGCCCTCAATTCTGGTGCCAAACTCGAGTTTGGCACCAGAATTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147779.1-948s21c1
Sequence:CCGGACTCTGATCAAGCGGGTTCAACTCGAGTTGAACCCGCTTGATCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147779
SFTPB MISSION shRNA shRNA Plasmid DNA
surfactant protein B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147779.1-1537s1c1
Sequence:CCGGAGTCTGTATGTCCCAGCTCTACTCGAGTAGAGCTGGGACATACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-1223s1c1
Sequence:CCGGCCATTTCTGCAAGTCTGTGATCTCGAGATCACAGACTTGCAGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-566s1c1
Sequence:CCGGCCTCCTCACAAAGATGACCAACTCGAGTTGGTCATCTTTGTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-612s1c1
Sequence:CCGGCGGAAGTTCCTGGAACAAGAACTCGAGTTCTTGTTCCAGGAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-439s1c1
Sequence:CCGGGCCCTCAATTCTGGTGCCAAACTCGAGTTTGGCACCAGAATTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147779.1-948s21c1
Sequence:CCGGACTCTGATCAAGCGGGTTCAACTCGAGTTGAACCCGCTTGATCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147779
SFTPB MISSION shRNA Lentiviral Transduction Particles
surfactant protein B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147779.1-1537s1c1
Sequence:CCGGAGTCTGTATGTCCCAGCTCTACTCGAGTAGAGCTGGGACATACAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-1223s1c1
Sequence:CCGGCCATTTCTGCAAGTCTGTGATCTCGAGATCACAGACTTGCAGAAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-566s1c1
Sequence:CCGGCCTCCTCACAAAGATGACCAACTCGAGTTGGTCATCTTTGTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-612s1c1
Sequence:CCGGCGGAAGTTCCTGGAACAAGAACTCGAGTTCTTGTTCCAGGAACTTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147779.1-439s1c1
Sequence:CCGGGCCCTCAATTCTGGTGCCAAACTCGAGTTTGGCACCAGAATTGAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147779.1-948s21c1
Sequence:CCGGACTCTGATCAAGCGGGTTCAACTCGAGTTGAACCCGCTTGATCAGAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)