EMAIL THIS PAGE TO A FRIEND

SFTPD

surfactant protein D

72 Gene Product Result for
Synonyms: COLEC7 PSP-D SFTP4 SP-D
Gene ID:
Mouse(20390) surfactant associated protein D
Rat(25350) surfactant protein D
cow(282072) surfactant protein D
dog(489066) surfactant protein D
domestic cat(101100595) surfactant protein D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003019 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003019 Rosetta Predictions human pricing
NM_012878 Rosetta Predictions rat pricing
XM_579354 Rosetta Predictions rat pricing
NM_009160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091767 predicted 693
2 SASI_Hs01_00091768 predicted 737
3 SASI_Hs02_00334916 predicted 766
4 SASI_Hs02_00334917 predicted 790
5 SASI_Hs01_00091769 predicted 726
6 SASI_Hs01_00091770 predicted 307
7 SASI_Hs01_00091771 predicted 689
8 SASI_Hs01_00091772 predicted 931
9 SASI_Hs01_00091773 predicted 918
10 SASI_Hs01_00091775 predicted 772
11 SASI_Hs01_00091774 predicted 983
12 SASI_Hs01_00091776 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260386 predicted 733
2 SASI_Rn01_00043998 predicted 663
3 SASI_Rn02_00260387 predicted 704
4 SASI_Rn01_00044000 predicted 776
5 SASI_Rn01_00044001 predicted 211
6 SASI_Rn02_00260388 predicted 410
7 SASI_Rn01_00044002 predicted 995
8 SASI_Rn01_00044003 predicted 885
9 SASI_Rn01_00044004 predicted 232
10 SASI_Rn01_00044005 predicted 921
11 SASI_Rn01_00043997 predicted 418
12 SASI_Rn01_00043999 predicted 320
13 SASI_Rn01_00044006 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139833 predicted 415
2 SASI_Rn01_00139834 predicted 431
3 SASI_Rn01_00139835 predicted 409
4 SASI_Rn01_00139836 predicted 407
5 SASI_Rn01_00139837 predicted 443
6 SASI_Rn01_00139838 predicted 426
7 SASI_Rn01_00139839 predicted 415
8 SASI_Rn01_00139840 predicted 388
9 SASI_Rn01_00139841 predicted 451
10 SASI_Rn01_00139842 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175169 predicted 437
2 SASI_Mm01_00175170 predicted 333
3 SASI_Mm02_00315500 predicted 284
4 SASI_Mm01_00175171 predicted 715
5 SASI_Mm02_00315501 predicted 680
6 SASI_Mm01_00175174 predicted 932
7 SASI_Mm01_00175176 predicted 421
8 SASI_Mm01_00175177 predicted 797
9 SASI_Mm01_00175178 predicted 903
10 SASI_Mm02_00315502 predicted 939
11 SASI_Mm01_00175172 predicted 305
12 SASI_Mm01_00175173 predicted 815
13 SASI_Mm01_00175175 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009160
SFTPD MISSION shRNA Bacterial Glycerol Stock
surfactant protein D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-919s1c1
Sequence:CCGGGCTACTGAGAATGCTGCCATACTCGAGTATGGCAGCATTCTCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-140s1c1
Sequence:CCGGCCTGCACCCTAGTCATGTGTACTCGAGTACACATGACTAGGGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-777s1c1
Sequence:CCGGCCACTATCAGAAAGCTGCATTCTCGAGAATGCAGCTTTCTGATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-433s1c1
Sequence:CCGGCAAGGCAAACCAGGTCCTAAACTCGAGTTTAGGACCTGGTTTGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-810s1c1
Sequence:CCGGCCGAAGTGTTGGAGACAAGATCTCGAGATCTTGTCTCCAACACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009160
SFTPD MISSION shRNA shRNA Plasmid DNA
surfactant protein D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-919s1c1
Sequence:CCGGGCTACTGAGAATGCTGCCATACTCGAGTATGGCAGCATTCTCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-140s1c1
Sequence:CCGGCCTGCACCCTAGTCATGTGTACTCGAGTACACATGACTAGGGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-777s1c1
Sequence:CCGGCCACTATCAGAAAGCTGCATTCTCGAGAATGCAGCTTTCTGATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-433s1c1
Sequence:CCGGCAAGGCAAACCAGGTCCTAAACTCGAGTTTAGGACCTGGTTTGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-810s1c1
Sequence:CCGGCCGAAGTGTTGGAGACAAGATCTCGAGATCTTGTCTCCAACACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009160
SFTPD MISSION shRNA Lentiviral Transduction Particles
surfactant protein D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-919s1c1
Sequence:CCGGGCTACTGAGAATGCTGCCATACTCGAGTATGGCAGCATTCTCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-140s1c1
Sequence:CCGGCCTGCACCCTAGTCATGTGTACTCGAGTACACATGACTAGGGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-777s1c1
Sequence:CCGGCCACTATCAGAAAGCTGCATTCTCGAGAATGCAGCTTTCTGATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-433s1c1
Sequence:CCGGCAAGGCAAACCAGGTCCTAAACTCGAGTTTAGGACCTGGTTTGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009160.1-810s1c1
Sequence:CCGGCCGAAGTGTTGGAGACAAGATCTCGAGATCTTGTCTCCAACACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003019
SFTPD MISSION shRNA Bacterial Glycerol Stock
surfactant protein D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-116s21c1
Sequence:CCGGACCTACTCCCACAGAACAATGCTCGAGCATTGTTCTGTGGGAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1066s1c1
Sequence:CCGGGCCTTGCAACAGCTGGTCGTACTCGAGTACGACCAGCTGTTGCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1233s1c1
Sequence:CCGGCTTCACCAATGGCAAGTGGAACTCGAGTTCCACTTGCCATTGGTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1107s1c1
Sequence:CCGGCCTGAGCATGACTGATTCCAACTCGAGTTGGAATCAGTCATGCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-894s1c1
Sequence:CCGGCCAGGCTGCTTTCTCTCAGTACTCGAGTACTGAGAGAAAGCAGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-221s1c1
Sequence:CCGGGCTACCTGGAAGCAGAAATGACTCGAGTCATTTCTGCTTCCAGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-740s21c1
Sequence:CCGGGCCTTACAGGGACAAGTACAGCTCGAGCTGTACTTGTCCCTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-1026s21c1
Sequence:CCGGCAGGAGAGTCCCTGGTCTATTCTCGAGAATAGACCAGGGACTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003019
SFTPD MISSION shRNA shRNA Plasmid DNA
surfactant protein D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-116s21c1
Sequence:CCGGACCTACTCCCACAGAACAATGCTCGAGCATTGTTCTGTGGGAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1066s1c1
Sequence:CCGGGCCTTGCAACAGCTGGTCGTACTCGAGTACGACCAGCTGTTGCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1233s1c1
Sequence:CCGGCTTCACCAATGGCAAGTGGAACTCGAGTTCCACTTGCCATTGGTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1107s1c1
Sequence:CCGGCCTGAGCATGACTGATTCCAACTCGAGTTGGAATCAGTCATGCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-894s1c1
Sequence:CCGGCCAGGCTGCTTTCTCTCAGTACTCGAGTACTGAGAGAAAGCAGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-221s1c1
Sequence:CCGGGCTACCTGGAAGCAGAAATGACTCGAGTCATTTCTGCTTCCAGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-740s21c1
Sequence:CCGGGCCTTACAGGGACAAGTACAGCTCGAGCTGTACTTGTCCCTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-1026s21c1
Sequence:CCGGCAGGAGAGTCCCTGGTCTATTCTCGAGAATAGACCAGGGACTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003019
SFTPD MISSION shRNA Lentiviral Transduction Particles
surfactant protein D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-116s21c1
Sequence:CCGGACCTACTCCCACAGAACAATGCTCGAGCATTGTTCTGTGGGAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1066s1c1
Sequence:CCGGGCCTTGCAACAGCTGGTCGTACTCGAGTACGACCAGCTGTTGCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1233s1c1
Sequence:CCGGCTTCACCAATGGCAAGTGGAACTCGAGTTCCACTTGCCATTGGTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-1107s1c1
Sequence:CCGGCCTGAGCATGACTGATTCCAACTCGAGTTGGAATCAGTCATGCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-894s1c1
Sequence:CCGGCCAGGCTGCTTTCTCTCAGTACTCGAGTACTGAGAGAAAGCAGCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003019.3-221s1c1
Sequence:CCGGGCTACCTGGAAGCAGAAATGACTCGAGTCATTTCTGCTTCCAGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-740s21c1
Sequence:CCGGGCCTTACAGGGACAAGTACAGCTCGAGCTGTACTTGTCCCTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003019.4-1026s21c1
Sequence:CCGGCAGGAGAGTCCCTGGTCTATTCTCGAGAATAGACCAGGGACTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)