EMAIL THIS PAGE TO A FRIEND

SFXN4

sideroflexin 4

68 Gene Product Result for
Synonyms: BCRM1
UniProtKB ID: Q6P4A7, Q6WSU4, Q86TD9
Gene ID:
Mouse(94281) sideroflexin 4
Rat(361778) sideroflexin 4
cow(508473) sideroflexin 4
sheep(101106478) sideroflexin 4
Zebrafish(556121) sideroflexin 4
domestic cat(101093965) sideroflexin 4
dog(477838) sideroflexin 4
chicken(771604) sideroflexin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213650 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070841 MISSION® esiRNA esiRNA targeting mouse Sfxn4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178867 Rosetta Predictions human pricing
NM_213649 Rosetta Predictions human pricing
NM_213650 Rosetta Predictions human pricing
NM_001108527 Rosetta Predictions rat pricing
NM_053198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096934 predicted 584
2 SASI_Hs01_00096935 predicted 507
3 SASI_Hs01_00096936 predicted 717
4 SASI_Hs01_00096937 predicted 616
5 SASI_Hs01_00096938 predicted 715
6 SASI_Hs01_00096939 predicted 502
7 SASI_Hs01_00096940 predicted 628
8 SASI_Hs01_00096941 predicted 639
9 SASI_Hs01_00096942 predicted 543
10 SASI_Hs01_00096943 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374325 predicted 975
2 SASI_Hs01_00110732 predicted 643
3 SASI_Hs02_00374326 predicted 236
4 SASI_Hs02_00374327 predicted 911
5 SASI_Hs02_00374328 predicted 507
6 SASI_Hs01_00110738 predicted 559
7 SASI_Hs02_00374329 predicted 1068
8 SASI_Hs02_00374330 predicted 196
9 SASI_Hs02_00374331 predicted 594
10 SASI_Hs02_00374332 predicted 295
11 SASI_Hs01_00110729 predicted 616
12 SASI_Hs01_00110730 predicted 530
13 SASI_Hs01_00110731 predicted 741
14 SASI_Hs01_00110733 predicted 743
15 SASI_Hs01_00110734 predicted 527
16 SASI_Hs01_00110735 predicted 528
17 SASI_Hs01_00110736 predicted 664
18 SASI_Hs01_00110737 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047175 predicted 614
2 SASI_Hs01_00047176 predicted 533
3 SASI_Hs01_00047177 predicted 740
4 SASI_Hs01_00047178 predicted 642
5 SASI_Hs01_00047179 predicted 738
6 SASI_Hs01_00047180 predicted 524
7 SASI_Hs01_00047181 predicted 522
8 SASI_Hs01_00047182 predicted 661
9 SASI_Hs01_00047183 predicted 668
10 SASI_Hs01_00047184 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239519 predicted 258
2 SASI_Rn02_00239520 predicted 1065
3 SASI_Rn02_00239521 predicted 691
4 SASI_Rn02_00239522 predicted 618
5 SASI_Rn02_00239523 predicted 478
6 SASI_Rn02_00239524 predicted 527
7 SASI_Rn02_00239525 predicted 931
8 SASI_Rn02_00239526 predicted 894
9 SASI_Rn02_00239527 predicted 462
10 SASI_Rn02_00239528 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337777 predicted 904
2 SASI_Mm01_00071343 predicted 237
3 SASI_Mm01_00071344 predicted 251
4 SASI_Mm01_00071345 predicted 661
5 SASI_Mm01_00071346 predicted 213
6 SASI_Mm01_00071347 predicted 523
7 SASI_Mm01_00071348 predicted 452
8 SASI_Mm01_00071349 predicted 732
9 SASI_Mm01_00071350 predicted 960
10 SASI_Mm01_00071351 predicted 858
11 SASI_Mm01_00071352 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213650
SFXN4 MISSION shRNA Bacterial Glycerol Stock
sideroflexin 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213650.1-1114s1c1
Sequence:CCGGAGGTTCGGTTTAGAGAACTTTCTCGAGAAAGTTCTCTAAACCGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-796s1c1
Sequence:CCGGGCATCCAGAATAGTGCTGTTTCTCGAGAAACAGCACTATTCTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-239s1c1
Sequence:CCGGCGAGGCAACTATTGTGCACAACTCGAGTTGTGCACAATAGTTGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-555s1c1
Sequence:CCGGAGCCGTTGCTTCTTCAACTTTCTCGAGAAAGTTGAAGAAGCAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-481s1c1
Sequence:CCGGGCAGCGTTCAACAGCATCAATCTCGAGATTGATGCTGTTGAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213650
SFXN4 MISSION shRNA shRNA Plasmid DNA
sideroflexin 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213650.1-1114s1c1
Sequence:CCGGAGGTTCGGTTTAGAGAACTTTCTCGAGAAAGTTCTCTAAACCGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-796s1c1
Sequence:CCGGGCATCCAGAATAGTGCTGTTTCTCGAGAAACAGCACTATTCTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-239s1c1
Sequence:CCGGCGAGGCAACTATTGTGCACAACTCGAGTTGTGCACAATAGTTGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-555s1c1
Sequence:CCGGAGCCGTTGCTTCTTCAACTTTCTCGAGAAAGTTGAAGAAGCAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-481s1c1
Sequence:CCGGGCAGCGTTCAACAGCATCAATCTCGAGATTGATGCTGTTGAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213650
SFXN4 MISSION shRNA Lentiviral Transduction Particles
sideroflexin 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213650.1-1114s1c1
Sequence:CCGGAGGTTCGGTTTAGAGAACTTTCTCGAGAAAGTTCTCTAAACCGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-796s1c1
Sequence:CCGGGCATCCAGAATAGTGCTGTTTCTCGAGAAACAGCACTATTCTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-239s1c1
Sequence:CCGGCGAGGCAACTATTGTGCACAACTCGAGTTGTGCACAATAGTTGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-555s1c1
Sequence:CCGGAGCCGTTGCTTCTTCAACTTTCTCGAGAAAGTTGAAGAAGCAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213650.1-481s1c1
Sequence:CCGGGCAGCGTTCAACAGCATCAATCTCGAGATTGATGCTGTTGAACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053198
VALIDATED
SFXN4 MISSION shRNA Bacterial Glycerol Stock
sideroflexin 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053198.2-239s1c1
Sequence:CCGGACCTGGATAACCAAGTGATTACTCGAGTAATCACTTGGTTATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-240s1c1
Sequence:CCGGCCTGGATAACCAAGTGATTAACTCGAGTTAATCACTTGGTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-904s1c1
Sequence:CCGGCCAGTGTCATTCAGCATGTTTCTCGAGAAACATGCTGAATGACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053198.2-1159s1c1
Sequence:CCGGGCTGAGATGAAGTAAGAGTCACTCGAGTGACTCTTACTTCATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-151s21c1
Sequence:CCGGTGTCAGTGGATGGATTTATTACTCGAGTAATAAATCCATCCACTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-724s1c1
Sequence:CCGGGCTGGAAGAAAGGCTATTAAACTCGAGTTTAATAGCCTTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-407s21c1
Sequence:CCGGCTGGAATAAAGTCCATCATTTCTCGAGAAATGATGGACTTTATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053198.3-1177s21c1
Sequence:CCGGGCTGAGATGAAGTAAGAGTCACTCGAGTGACTCTTACTTCATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-742s21c1
Sequence:CCGGGCTGGAAGAAAGGCTATTAAACTCGAGTTTAATAGCCTTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-614s21c1
Sequence:CCGGGAACCTTGCCAATCGTCTTTCCTCGAGGAAAGACGATTGGCAAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-447s21c1
Sequence:CCGGTGGATACACCACAGCCTTTAACTCGAGTTAAAGGCTGTGGTGTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053198
VALIDATED
SFXN4 MISSION shRNA shRNA Plasmid DNA
sideroflexin 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053198.2-239s1c1
Sequence:CCGGACCTGGATAACCAAGTGATTACTCGAGTAATCACTTGGTTATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-240s1c1
Sequence:CCGGCCTGGATAACCAAGTGATTAACTCGAGTTAATCACTTGGTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-904s1c1
Sequence:CCGGCCAGTGTCATTCAGCATGTTTCTCGAGAAACATGCTGAATGACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053198.2-1159s1c1
Sequence:CCGGGCTGAGATGAAGTAAGAGTCACTCGAGTGACTCTTACTTCATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-151s21c1
Sequence:CCGGTGTCAGTGGATGGATTTATTACTCGAGTAATAAATCCATCCACTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-724s1c1
Sequence:CCGGGCTGGAAGAAAGGCTATTAAACTCGAGTTTAATAGCCTTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-407s21c1
Sequence:CCGGCTGGAATAAAGTCCATCATTTCTCGAGAAATGATGGACTTTATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053198.3-1177s21c1
Sequence:CCGGGCTGAGATGAAGTAAGAGTCACTCGAGTGACTCTTACTTCATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-742s21c1
Sequence:CCGGGCTGGAAGAAAGGCTATTAAACTCGAGTTTAATAGCCTTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-614s21c1
Sequence:CCGGGAACCTTGCCAATCGTCTTTCCTCGAGGAAAGACGATTGGCAAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-447s21c1
Sequence:CCGGTGGATACACCACAGCCTTTAACTCGAGTTAAAGGCTGTGGTGTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053198
VALIDATED
SFXN4 MISSION shRNA Lentiviral Transduction Particles
sideroflexin 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053198.2-239s1c1
Sequence:CCGGACCTGGATAACCAAGTGATTACTCGAGTAATCACTTGGTTATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-240s1c1
Sequence:CCGGCCTGGATAACCAAGTGATTAACTCGAGTTAATCACTTGGTTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-904s1c1
Sequence:CCGGCCAGTGTCATTCAGCATGTTTCTCGAGAAACATGCTGAATGACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053198.2-1159s1c1
Sequence:CCGGGCTGAGATGAAGTAAGAGTCACTCGAGTGACTCTTACTTCATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-151s21c1
Sequence:CCGGTGTCAGTGGATGGATTTATTACTCGAGTAATAAATCCATCCACTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053198.2-724s1c1
Sequence:CCGGGCTGGAAGAAAGGCTATTAAACTCGAGTTTAATAGCCTTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-407s21c1
Sequence:CCGGCTGGAATAAAGTCCATCATTTCTCGAGAAATGATGGACTTTATTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053198.3-1177s21c1
Sequence:CCGGGCTGAGATGAAGTAAGAGTCACTCGAGTGACTCTTACTTCATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-742s21c1
Sequence:CCGGGCTGGAAGAAAGGCTATTAAACTCGAGTTTAATAGCCTTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-614s21c1
Sequence:CCGGGAACCTTGCCAATCGTCTTTCCTCGAGGAAAGACGATTGGCAAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053198.3-447s21c1
Sequence:CCGGTGGATACACCACAGCCTTTAACTCGAGTTAAAGGCTGTGGTGTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)