EMAIL THIS PAGE TO A FRIEND

SGCA

sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)

48 Gene Product Result for
Synonyms: 50-DAG A2 ADL DAG2 DMDA2 LGMD2D SCARMD1 adhalin
UniProtKB ID: Q16586, A6NEB8, A8K3K7, Q13710, Q13712
Gene ID:
Human(6442) Summary: This gene encodes a component of the dystrophin-glycoprotein complex (DGC), which is critical to the stability of muscle fiber membranes and to the linking of the actin cytoskeleton to the extracellular matrix. Its expression is thought to be restricted to striated muscle. Mutations in this gene result in type 2D autosomal recessive limb-girdle muscular dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(20391) sarcoglycan, alpha (dystrophin-associated glycoprotein)
Rat(303468) sarcoglycan, alpha (dystrophin-associated glycoprotein)
dog(609265) sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Horse(100056285) sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
domestic cat(101092469) sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
cow(541308) sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
sheep(101108143) sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
naked mole-rat(101702821) sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
domestic guinea pig(100733677) sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000023 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149461 MISSION® esiRNA esiRNA human SGCA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000023 Rosetta Predictions human pricing
NM_001107039 Rosetta Predictions rat pricing
NM_009161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163806 predicted 328
2 SASI_Hs01_00163807 predicted 1085
3 SASI_Hs01_00163808 predicted 506
4 SASI_Hs01_00163810 predicted 1152
5 SASI_Hs01_00163811 predicted 724
6 SASI_Hs01_00163812 predicted 919
7 SASI_Hs01_00163813 predicted 683
8 SASI_Hs01_00163814 predicted 338
9 SASI_Hs01_00163815 predicted 981
10 SASI_Hs02_00301686 predicted 738
11 SASI_Hs01_00163809 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224886 predicted 1048
2 SASI_Rn02_00224887 predicted 330
3 SASI_Rn02_00224888 predicted 515
4 SASI_Rn02_00224889 predicted 915
5 SASI_Rn02_00224890 predicted 337
6 SASI_Rn02_00224891 predicted 463
7 SASI_Rn02_00224892 predicted 484
8 SASI_Rn02_00224893 predicted 1301
9 SASI_Rn02_00224894 predicted 1320
10 SASI_Rn02_00224895 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315503 predicted 316
2 SASI_Mm01_00021662 predicted 753
3 SASI_Mm01_00021663 predicted 1159
4 SASI_Mm01_00021664 predicted 568
5 SASI_Mm01_00021665 predicted 565
6 SASI_Mm01_00021666 predicted 384
7 SASI_Mm01_00021667 predicted 670
8 SASI_Mm01_00021668 predicted 1115
9 SASI_Mm01_00021669 predicted 488
10 SASI_Mm01_00021670 predicted 540
11 SASI_Mm01_00021671 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009161
SGCA MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-561s21c1
Sequence:CCGGTCGAGGTCACAGCCTACAATCCTCGAGGATTGTAGGCTGTGACCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-1255s21c1
Sequence:CCGGCTGTTCCATCCATGGGAATACCTCGAGGTATTCCCATGGATGGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009161.1-839s1c1
Sequence:CCGGGTATACATTAAGGTAGGCTCTCTCGAGAGAGCCTACCTTAATGTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009161.1-646s1c1
Sequence:CCGGGTTGCCATACCAAGCTGAGTTCTCGAGAACTCAGCTTGGTATGGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-488s21c1
Sequence:CCGGACACAGCGCAGTCCCTATAACCTCGAGGTTATAGGGACTGCGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-941s21c1
Sequence:CCGGCTGTCCTGCTACGACACTTTGCTCGAGCAAAGTGTCGTAGCAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009161
SGCA MISSION shRNA shRNA Plasmid DNA
sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-561s21c1
Sequence:CCGGTCGAGGTCACAGCCTACAATCCTCGAGGATTGTAGGCTGTGACCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-1255s21c1
Sequence:CCGGCTGTTCCATCCATGGGAATACCTCGAGGTATTCCCATGGATGGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009161.1-839s1c1
Sequence:CCGGGTATACATTAAGGTAGGCTCTCTCGAGAGAGCCTACCTTAATGTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009161.1-646s1c1
Sequence:CCGGGTTGCCATACCAAGCTGAGTTCTCGAGAACTCAGCTTGGTATGGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-488s21c1
Sequence:CCGGACACAGCGCAGTCCCTATAACCTCGAGGTTATAGGGACTGCGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-941s21c1
Sequence:CCGGCTGTCCTGCTACGACACTTTGCTCGAGCAAAGTGTCGTAGCAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009161
SGCA MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-561s21c1
Sequence:CCGGTCGAGGTCACAGCCTACAATCCTCGAGGATTGTAGGCTGTGACCTCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-1255s21c1
Sequence:CCGGCTGTTCCATCCATGGGAATACCTCGAGGTATTCCCATGGATGGAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009161.1-839s1c1
Sequence:CCGGGTATACATTAAGGTAGGCTCTCTCGAGAGAGCCTACCTTAATGTATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009161.1-646s1c1
Sequence:CCGGGTTGCCATACCAAGCTGAGTTCTCGAGAACTCAGCTTGGTATGGCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-488s21c1
Sequence:CCGGACACAGCGCAGTCCCTATAACCTCGAGGTTATAGGGACTGCGCTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009161.3-941s21c1
Sequence:CCGGCTGTCCTGCTACGACACTTTGCTCGAGCAAAGTGTCGTAGCAGGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000023
SGCA MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-330s1c1
Sequence:CCGGGCCTACAATCGGGACAGCTTTCTCGAGAAAGCTGTCCCGATTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-135s1c1
Sequence:CCGGCATGAGACGTTTCTGAGCCTTCTCGAGAAGGCTCAGAAACGTCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-569s1c1
Sequence:CCGGCCTTCCCATTGAGGGCCGAAACTCGAGTTTCGGCCCTCAATGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-815s1c1
Sequence:CCGGCCTGGAGCATGACCCGTTCTTCTCGAGAAGAACGGGTCATGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-404s1c1
Sequence:CCGGGCTGCCATACCAAGCCGAGTTCTCGAGAACTCGGCTTGGTATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000023.2-1270s21c1
Sequence:CCGGACATCCCACCTGCTGATTCCACTCGAGTGGAATCAGCAGGTGGGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000023.2-125s21c1
Sequence:CCGGCACTTGTGGGCCGTGTCTTTGCTCGAGCAAAGACACGGCCCACAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000023.2-326s21c1
Sequence:CCGGATCGTGGGCTCCAGGTCATTGCTCGAGCAATGACCTGGAGCCCACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000023
SGCA MISSION shRNA shRNA Plasmid DNA
sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-330s1c1
Sequence:CCGGGCCTACAATCGGGACAGCTTTCTCGAGAAAGCTGTCCCGATTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-135s1c1
Sequence:CCGGCATGAGACGTTTCTGAGCCTTCTCGAGAAGGCTCAGAAACGTCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-569s1c1
Sequence:CCGGCCTTCCCATTGAGGGCCGAAACTCGAGTTTCGGCCCTCAATGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-815s1c1
Sequence:CCGGCCTGGAGCATGACCCGTTCTTCTCGAGAAGAACGGGTCATGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-404s1c1
Sequence:CCGGGCTGCCATACCAAGCCGAGTTCTCGAGAACTCGGCTTGGTATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000023.2-1270s21c1
Sequence:CCGGACATCCCACCTGCTGATTCCACTCGAGTGGAATCAGCAGGTGGGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000023.2-125s21c1
Sequence:CCGGCACTTGTGGGCCGTGTCTTTGCTCGAGCAAAGACACGGCCCACAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000023.2-326s21c1
Sequence:CCGGATCGTGGGCTCCAGGTCATTGCTCGAGCAATGACCTGGAGCCCACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000023
SGCA MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-330s1c1
Sequence:CCGGGCCTACAATCGGGACAGCTTTCTCGAGAAAGCTGTCCCGATTGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-135s1c1
Sequence:CCGGCATGAGACGTTTCTGAGCCTTCTCGAGAAGGCTCAGAAACGTCTCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-569s1c1
Sequence:CCGGCCTTCCCATTGAGGGCCGAAACTCGAGTTTCGGCCCTCAATGGGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-815s1c1
Sequence:CCGGCCTGGAGCATGACCCGTTCTTCTCGAGAAGAACGGGTCATGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000023.1-404s1c1
Sequence:CCGGGCTGCCATACCAAGCCGAGTTCTCGAGAACTCGGCTTGGTATGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000023.2-1270s21c1
Sequence:CCGGACATCCCACCTGCTGATTCCACTCGAGTGGAATCAGCAGGTGGGATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000023.2-125s21c1
Sequence:CCGGCACTTGTGGGCCGTGTCTTTGCTCGAGCAAAGACACGGCCCACAAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000023.2-326s21c1
Sequence:CCGGATCGTGGGCTCCAGGTCATTGCTCGAGCAATGACCTGGAGCCCACGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)