EMAIL THIS PAGE TO A FRIEND

SGCB

sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)

181 Gene Product Result for
Synonyms: A3b LGMD2E SGC
UniProtKB ID: Q16585, O00661
Gene ID:
Human(6443) Summary: This gene encodes a member of the sarcoglycan family. Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix. Mutations in this gene have been associated with limb-girdle muscular dystrophy.[provided by RefSeq, Oct 2008]
Mouse(24051) sarcoglycan, beta (dystrophin-associated glycoprotein)
Rat(680229) sarcoglycan, beta (dystrophin-associated glycoprotein)
Zebrafish(559788) sarcoglycan, beta (dystrophin-associated glycoprotein)
dog(611066) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
domestic cat(101087316) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
dog(482147) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
chicken(422760) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
domestic guinea pig(100723371) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
naked mole-rat(101704913) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Domestic Rabbit(100009208) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
cow(535372) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
sheep(101113852) sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000232 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000232 Rosetta Predictions human pricing
XM_001056227 Rosetta Predictions rat pricing
NM_011890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019352 predicted 682
2 SASI_Hs01_00019353 predicted 894
3 SASI_Hs01_00019355 predicted 328
4 SASI_Hs01_00019356 predicted 731
5 SASI_Hs01_00019357 predicted 308
6 SASI_Hs01_00019358 predicted 468
7 SASI_Hs01_00019359 predicted 1050
8 SASI_Hs01_00019360 predicted 267
9 SASI_Hs01_00019361 predicted 467
10 SASI_Hs02_00302141 predicted 710
11 SASI_Hs01_00019354 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282528 predicted 634
2 SASI_Rn02_00282529 predicted 727
3 SASI_Rn02_00282530 predicted 1197
4 SASI_Rn02_00282531 predicted 410
5 SASI_Rn02_00282532 predicted 420
6 SASI_Rn02_00282533 predicted 534
7 SASI_Rn02_00282534 predicted 850
8 SASI_Rn02_00282535 predicted 897
9 SASI_Rn02_00282536 predicted 601
10 SASI_Rn02_00282537 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187198 predicted 1036
2 SASI_Mm01_00187200 predicted 653
3 SASI_Mm01_00187201 predicted 563
4 SASI_Mm02_00321696 predicted 737
5 SASI_Mm01_00187203 predicted 1176
6 SASI_Mm01_00187204 predicted 1126
7 SASI_Mm01_00187205 predicted 1045
8 SASI_Mm01_00187206 predicted 1106
9 SASI_Mm01_00187207 predicted 687
10 SASI_Mm02_00321697 predicted 380
11 SASI_Mm01_00187199 predicted 1169
12 SASI_Mm01_00187202 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011890
VALIDATED
SGCB MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011890.4-1065s21c1
Sequence:CCGGGCGTTTGCCATAACTTGTAATCTCGAGATTACAAGTTATGGCAAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011890.4-1113s21c1
Sequence:CCGGCTATTATGTACTCTCCATATTCTCGAGAATATGGAGAGTACATAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-572s21c1
Sequence:CCGGACTATGAGACGCACGAGTTTCCTCGAGGAAACTCGTGCGTCTCATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-226s21c1
Sequence:CCGGGTGATCGTCCTCCTGTTTATCCTCGAGGATAAACAGGAGGACGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-107s21c1
Sequence:CCGGAGCGGAGGAATGTTAACAAAGCTCGAGCTTTGTTAACATTCCTCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-668s1c1
Sequence:CCGGCAATGCTACCAGTGACTTAAACTCGAGTTTAAGTCACTGGTAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011890.2-2670s1c1
Sequence:CCGGCCAGACACTAAGTGCAGATTTCTCGAGAAATCTGCACTTAGTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-929s1c1
Sequence:CCGGAGTACAAGTAACAGGTCACAACTCGAGTTGTGACCTGTTACTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-151s1c1
Sequence:CCGGGCAATTTCAAAGCTGGATATACTCGAGTATATCCAGCTTTGAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011890.2-264s1c1
Sequence:CCGGGCCGTCATCAATCTACTCATTCTCGAGAATGAGTAGATTGATGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011890
VALIDATED
SGCB MISSION shRNA shRNA Plasmid DNA
sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011890.4-1065s21c1
Sequence:CCGGGCGTTTGCCATAACTTGTAATCTCGAGATTACAAGTTATGGCAAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011890.4-1113s21c1
Sequence:CCGGCTATTATGTACTCTCCATATTCTCGAGAATATGGAGAGTACATAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-572s21c1
Sequence:CCGGACTATGAGACGCACGAGTTTCCTCGAGGAAACTCGTGCGTCTCATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-226s21c1
Sequence:CCGGGTGATCGTCCTCCTGTTTATCCTCGAGGATAAACAGGAGGACGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-107s21c1
Sequence:CCGGAGCGGAGGAATGTTAACAAAGCTCGAGCTTTGTTAACATTCCTCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-668s1c1
Sequence:CCGGCAATGCTACCAGTGACTTAAACTCGAGTTTAAGTCACTGGTAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011890.2-2670s1c1
Sequence:CCGGCCAGACACTAAGTGCAGATTTCTCGAGAAATCTGCACTTAGTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-929s1c1
Sequence:CCGGAGTACAAGTAACAGGTCACAACTCGAGTTGTGACCTGTTACTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-151s1c1
Sequence:CCGGGCAATTTCAAAGCTGGATATACTCGAGTATATCCAGCTTTGAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011890.2-264s1c1
Sequence:CCGGGCCGTCATCAATCTACTCATTCTCGAGAATGAGTAGATTGATGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011890
VALIDATED
SGCB MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011890.4-1065s21c1
Sequence:CCGGGCGTTTGCCATAACTTGTAATCTCGAGATTACAAGTTATGGCAAACGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011890.4-1113s21c1
Sequence:CCGGCTATTATGTACTCTCCATATTCTCGAGAATATGGAGAGTACATAATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-572s21c1
Sequence:CCGGACTATGAGACGCACGAGTTTCCTCGAGGAAACTCGTGCGTCTCATAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-226s21c1
Sequence:CCGGGTGATCGTCCTCCTGTTTATCCTCGAGGATAAACAGGAGGACGATCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011890.4-107s21c1
Sequence:CCGGAGCGGAGGAATGTTAACAAAGCTCGAGCTTTGTTAACATTCCTCCGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-668s1c1
Sequence:CCGGCAATGCTACCAGTGACTTAAACTCGAGTTTAAGTCACTGGTAGCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011890.2-2670s1c1
Sequence:CCGGCCAGACACTAAGTGCAGATTTCTCGAGAAATCTGCACTTAGTGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-929s1c1
Sequence:CCGGAGTACAAGTAACAGGTCACAACTCGAGTTGTGACCTGTTACTTGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011890.2-151s1c1
Sequence:CCGGGCAATTTCAAAGCTGGATATACTCGAGTATATCCAGCTTTGAAATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011890.2-264s1c1
Sequence:CCGGGCCGTCATCAATCTACTCATTCTCGAGAATGAGTAGATTGATGACGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000232
VALIDATED
SGCB MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000232.4-941s21c1
Sequence:CCGGCGCTCTTCAAGGTGCAAGTAACTCGAGTTACTTGCACCTTGAAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-1166s21c1
Sequence:CCGGTCTTCTCAGAGAGCCTAAATTCTCGAGAATTTAGGCTCTCTGAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000232.3-4032s1c1
Sequence:CCGGCCTGACAAATAAGAGATCATTCTCGAGAATGATCTCTTATTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000232.3-145s1c1
Sequence:CCGGGCTGGATACATTCCGATTGATCTCGAGATCAATCGGAATGTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-902s1c1
Sequence:CCGGCGCTCTTCAAGGTGCAAGTAACTCGAGTTACTTGCACCTTGAAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-699s1c1
Sequence:CCGGGCGTGGAAATGAAGGTGTATTCTCGAGAATACACCTTCATTTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-688s1c1
Sequence:CCGGCGTGCTATTGTGCGTGGAAATCTCGAGATTTCCACGCACAATAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-373s21c1
Sequence:CCGGAGTGGCCTGCTTCGATTTAAGCTCGAGCTTAAATCGAAGCAGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-738s21c1
Sequence:CCGGGCGTGGAAATGAAGGTGTATTCTCGAGAATACACCTTCATTTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000232
VALIDATED
SGCB MISSION shRNA shRNA Plasmid DNA
sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000232.4-941s21c1
Sequence:CCGGCGCTCTTCAAGGTGCAAGTAACTCGAGTTACTTGCACCTTGAAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-1166s21c1
Sequence:CCGGTCTTCTCAGAGAGCCTAAATTCTCGAGAATTTAGGCTCTCTGAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000232.3-4032s1c1
Sequence:CCGGCCTGACAAATAAGAGATCATTCTCGAGAATGATCTCTTATTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000232.3-145s1c1
Sequence:CCGGGCTGGATACATTCCGATTGATCTCGAGATCAATCGGAATGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-902s1c1
Sequence:CCGGCGCTCTTCAAGGTGCAAGTAACTCGAGTTACTTGCACCTTGAAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-699s1c1
Sequence:CCGGGCGTGGAAATGAAGGTGTATTCTCGAGAATACACCTTCATTTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-688s1c1
Sequence:CCGGCGTGCTATTGTGCGTGGAAATCTCGAGATTTCCACGCACAATAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-373s21c1
Sequence:CCGGAGTGGCCTGCTTCGATTTAAGCTCGAGCTTAAATCGAAGCAGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-738s21c1
Sequence:CCGGGCGTGGAAATGAAGGTGTATTCTCGAGAATACACCTTCATTTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000232
VALIDATED
SGCB MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000232.4-941s21c1
Sequence:CCGGCGCTCTTCAAGGTGCAAGTAACTCGAGTTACTTGCACCTTGAAGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-1166s21c1
Sequence:CCGGTCTTCTCAGAGAGCCTAAATTCTCGAGAATTTAGGCTCTCTGAGAAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000232.3-4032s1c1
Sequence:CCGGCCTGACAAATAAGAGATCATTCTCGAGAATGATCTCTTATTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000232.3-145s1c1
Sequence:CCGGGCTGGATACATTCCGATTGATCTCGAGATCAATCGGAATGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-902s1c1
Sequence:CCGGCGCTCTTCAAGGTGCAAGTAACTCGAGTTACTTGCACCTTGAAGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-699s1c1
Sequence:CCGGGCGTGGAAATGAAGGTGTATTCTCGAGAATACACCTTCATTTCCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000232.3-688s1c1
Sequence:CCGGCGTGCTATTGTGCGTGGAAATCTCGAGATTTCCACGCACAATAGCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-373s21c1
Sequence:CCGGAGTGGCCTGCTTCGATTTAAGCTCGAGCTTAAATCGAAGCAGGCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000232.4-738s21c1
Sequence:CCGGGCGTGGAAATGAAGGTGTATTCTCGAGAATACACCTTCATTTCCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)