EMAIL THIS PAGE TO A FRIEND

SGCD

sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)

243 Gene Product Result for
Synonyms: 35DAG CMD1L DAGD SG-delta SGCDP SGD
UniProtKB ID: Q92629, A8K9S9, Q53XA5, Q99644
Gene ID:
Human(6444) Summary: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
Mouse(24052) sarcoglycan, delta (dystrophin-associated glycoprotein)
Rat(497892) sarcoglycan, delta (dystrophin-associated glycoprotein)
Zebrafish(324961) sarcoglycan, delta (dystrophin-associated glycoprotein)
chicken(416251) sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
dog(612079) sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
cow(517059) sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
sheep(101110936) sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
naked mole-rat(101712896) sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
domestic guinea pig(100733804) sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000337 Rosetta Predictions human pricing
NM_001128209 Rosetta Predictions human pricing
NM_172244 Rosetta Predictions human pricing
NM_001109029 Rosetta Predictions rat pricing
NM_001134826 Rosetta Predictions rat pricing
NM_011891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231009 predicted 820
2 SASI_Hs01_00231010 predicted 855
3 SASI_Hs01_00231011 predicted 870
4 SASI_Hs01_00231012 predicted 994
5 SASI_Hs01_00231013 predicted 668
6 SASI_Hs01_00231015 predicted 700
7 SASI_Hs01_00231016 predicted 703
8 SASI_Hs01_00231017 predicted 780
9 SASI_Hs01_00231018 predicted 668
10 SASI_Hs02_00302356 predicted 806
11 SASI_Hs01_00231014 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330836 predicted 731
2 SASI_Hs02_00330837 predicted 775
3 SASI_Hs02_00330838 predicted 803
4 SASI_Hs02_00330839 predicted 784
5 SASI_Hs02_00330840 predicted 833
6 SASI_Hs02_00330841 predicted 658
7 SASI_Hs02_00330842 predicted 655
8 SASI_Hs02_00330843 predicted 764
9 SASI_Hs02_00330844 predicted 762
10 SASI_Hs02_00330845 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177090 predicted 820
2 SASI_Hs01_00177091 predicted 849
3 SASI_Hs01_00177092 predicted 871
4 SASI_Hs01_00177093 predicted 990
5 SASI_Hs01_00177094 predicted 662
6 SASI_Hs01_00177096 predicted 702
7 SASI_Hs01_00177097 predicted 697
8 SASI_Hs01_00177098 predicted 779
9 SASI_Hs01_00177099 predicted 669
10 SASI_Hs02_00367957 predicted 808
11 SASI_Hs01_00177095 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244474 predicted 842
2 SASI_Rn02_00244475 predicted 897
3 SASI_Rn02_00244476 predicted 703
4 SASI_Rn02_00244477 predicted 660
5 SASI_Rn02_00244478 predicted 854
6 SASI_Rn02_00244479 predicted 896
7 SASI_Rn02_00244480 predicted 748
8 SASI_Rn02_00244481 predicted 689
9 SASI_Rn02_00244482 predicted 855
10 SASI_Rn02_00244483 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258604 predicted 947
2 SASI_Rn02_00258605 predicted 1001
3 SASI_Rn02_00258606 predicted 798
4 SASI_Rn02_00258607 predicted 765
5 SASI_Rn02_00258608 predicted 957
6 SASI_Rn02_00258609 predicted 993
7 SASI_Rn02_00258610 predicted 848
8 SASI_Rn02_00258611 predicted 795
9 SASI_Rn02_00258612 predicted 951
10 SASI_Rn02_00258613 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157350 predicted 238
2 SASI_Mm01_00157351 predicted 332
3 SASI_Mm01_00157352 predicted 219
4 SASI_Mm01_00157353 predicted 730
5 SASI_Mm01_00157354 predicted 542
6 SASI_Mm01_00157355 predicted 301
7 SASI_Mm01_00157356 predicted 200
8 SASI_Mm01_00157357 predicted 214
9 SASI_Mm01_00157358 predicted 282
10 SASI_Mm01_00157359 predicted 522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000337
VALIDATED
SGCD MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-2503s1c1
Sequence:CCGGCGGGATATTCATATTCCTAAACTCGAGTTTAGGAATATGAATATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-609s1c1
Sequence:CCGGGCGGAAACGATGCCTGTATTTCTCGAGAAATACAGGCATCGTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-998s1c1
Sequence:CCGGGAGCTGAAAGATTACGAGTTTCTCGAGAAACTCGTAATCTTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-678s1c1
Sequence:CCGGCATCTGGATTCTCAAAGTCATCTCGAGATGACTTTGAGAATCCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-1031s1c1
Sequence:CCGGGCACAGTGTTCCCTAAATCTACTCGAGTAGATTTAGGGAACACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-879s21c1
Sequence:CCGGAGTGCTAACTCAGCTTATAACCTCGAGGTTATAAGCTGAGTTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-1314s21c1
Sequence:CCGGCTGCGCCAATGGGAGATTATTCTCGAGAATAATCTCCCATTGGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-910s21c1
Sequence:CCGGGCCGTAGAAGCTTATGGTAAACTCGAGTTTACCATAAGCTTCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000337.5-998s21c1
Sequence:CCGGGAGCTGAAAGATTACGAGTTTCTCGAGAAACTCGTAATCTTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000337.5-2503s21c1
Sequence:CCGGCGGGATATTCATATTCCTAAACTCGAGTTTAGGAATATGAATATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000337
VALIDATED
SGCD MISSION shRNA shRNA Plasmid DNA
sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-2503s1c1
Sequence:CCGGCGGGATATTCATATTCCTAAACTCGAGTTTAGGAATATGAATATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-609s1c1
Sequence:CCGGGCGGAAACGATGCCTGTATTTCTCGAGAAATACAGGCATCGTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-998s1c1
Sequence:CCGGGAGCTGAAAGATTACGAGTTTCTCGAGAAACTCGTAATCTTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-678s1c1
Sequence:CCGGCATCTGGATTCTCAAAGTCATCTCGAGATGACTTTGAGAATCCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-1031s1c1
Sequence:CCGGGCACAGTGTTCCCTAAATCTACTCGAGTAGATTTAGGGAACACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-879s21c1
Sequence:CCGGAGTGCTAACTCAGCTTATAACCTCGAGGTTATAAGCTGAGTTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-1314s21c1
Sequence:CCGGCTGCGCCAATGGGAGATTATTCTCGAGAATAATCTCCCATTGGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-910s21c1
Sequence:CCGGGCCGTAGAAGCTTATGGTAAACTCGAGTTTACCATAAGCTTCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000337.5-998s21c1
Sequence:CCGGGAGCTGAAAGATTACGAGTTTCTCGAGAAACTCGTAATCTTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000337.5-2503s21c1
Sequence:CCGGCGGGATATTCATATTCCTAAACTCGAGTTTAGGAATATGAATATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000337
VALIDATED
SGCD MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-2503s1c1
Sequence:CCGGCGGGATATTCATATTCCTAAACTCGAGTTTAGGAATATGAATATCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-609s1c1
Sequence:CCGGGCGGAAACGATGCCTGTATTTCTCGAGAAATACAGGCATCGTTTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-998s1c1
Sequence:CCGGGAGCTGAAAGATTACGAGTTTCTCGAGAAACTCGTAATCTTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-678s1c1
Sequence:CCGGCATCTGGATTCTCAAAGTCATCTCGAGATGACTTTGAGAATCCAGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000337.4-1031s1c1
Sequence:CCGGGCACAGTGTTCCCTAAATCTACTCGAGTAGATTTAGGGAACACTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-879s21c1
Sequence:CCGGAGTGCTAACTCAGCTTATAACCTCGAGGTTATAAGCTGAGTTAGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-1314s21c1
Sequence:CCGGCTGCGCCAATGGGAGATTATTCTCGAGAATAATCTCCCATTGGCGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000337.5-910s21c1
Sequence:CCGGGCCGTAGAAGCTTATGGTAAACTCGAGTTTACCATAAGCTTCTACGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000337.5-998s21c1
Sequence:CCGGGAGCTGAAAGATTACGAGTTTCTCGAGAAACTCGTAATCTTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000337.5-2503s21c1
Sequence:CCGGCGGGATATTCATATTCCTAAACTCGAGTTTAGGAATATGAATATCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011891
SGCD MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011891.2-1204s1c1
Sequence:CCGGCCCATCATCCACATGACAGAACTCGAGTTCTGTCATGTGGATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-529s1c1
Sequence:CCGGGCTGAGAGATTGAGAGTCTTACTCGAGTAAGACTCTCAATCTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-335s1c1
Sequence:CCGGCCCGACCAGGTAATGCCCTATCTCGAGATAGGGCATTACCTGGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-228s1c1
Sequence:CCGGGAACTTCACAATTGATGGAATCTCGAGATTCCATCAATTGTGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-572s1c1
Sequence:CCGGCCAAATCCATAGAAACACCTACTCGAGTAGGTGTTTCTATGGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011891
SGCD MISSION shRNA shRNA Plasmid DNA
sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011891.2-1204s1c1
Sequence:CCGGCCCATCATCCACATGACAGAACTCGAGTTCTGTCATGTGGATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-529s1c1
Sequence:CCGGGCTGAGAGATTGAGAGTCTTACTCGAGTAAGACTCTCAATCTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-335s1c1
Sequence:CCGGCCCGACCAGGTAATGCCCTATCTCGAGATAGGGCATTACCTGGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-228s1c1
Sequence:CCGGGAACTTCACAATTGATGGAATCTCGAGATTCCATCAATTGTGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-572s1c1
Sequence:CCGGCCAAATCCATAGAAACACCTACTCGAGTAGGTGTTTCTATGGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011891
SGCD MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011891.2-1204s1c1
Sequence:CCGGCCCATCATCCACATGACAGAACTCGAGTTCTGTCATGTGGATGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-529s1c1
Sequence:CCGGGCTGAGAGATTGAGAGTCTTACTCGAGTAAGACTCTCAATCTCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-335s1c1
Sequence:CCGGCCCGACCAGGTAATGCCCTATCTCGAGATAGGGCATTACCTGGTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-228s1c1
Sequence:CCGGGAACTTCACAATTGATGGAATCTCGAGATTCCATCAATTGTGAAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011891.2-572s1c1
Sequence:CCGGCCAAATCCATAGAAACACCTACTCGAGTAGGTGTTTCTATGGATTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)