EMAIL THIS PAGE TO A FRIEND

SGCG

sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)

53 Gene Product Result for
Synonyms: A4 DAGA4 DMDA DMDA1 LGMD2C MAM SCARMD2 SCG3 TYPE
UniProtKB ID: Q13326, Q32M32, Q5T9J6
Gene ID:
Human(6445) Summary: This gene encodes gamma-sarcoglycan, one of several sarcolemmal transmembrane glycoproteins that interact with dystrophin. The dystrophin-glycoprotein complex (DGC) spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Defects in the encoded protein can lead to early onset autosomal recessive muscular dystrophy, in particular limb-girdle muscular dystrophy, type 2C (LGMD2C). [provided by RefSeq, Oct 2008]
Mouse(24053) sarcoglycan, gamma (dystrophin-associated glycoprotein)
Rat(305941) sarcoglycan, gamma (dystrophin-associated glycoprotein)
Zebrafish(445292) sarcoglycan, gamma
dog(486043) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
domestic cat(101084593) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
chicken(418945) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
cow(506155) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
sheep(101116584) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Domestic Rabbit(100009214) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
naked mole-rat(101700577) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
domestic guinea pig(100716857) sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000231 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023801 MISSION® esiRNA esiRNA human SGCG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000231 Rosetta Predictions human pricing
NM_001006993 Rosetta Predictions rat pricing
NM_011892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036676 predicted 566
2 SASI_Hs01_00036677 predicted 227
3 SASI_Hs01_00036678 predicted 276
4 SASI_Hs01_00036679 predicted 265
5 SASI_Hs01_00036680 predicted 278
6 SASI_Hs02_00302137 predicted 225
7 SASI_Hs01_00036684 predicted 667
8 SASI_Hs02_00302138 predicted 1133
9 SASI_Hs02_00302139 predicted 262
10 SASI_Hs02_00302140 predicted 1332
11 SASI_Hs01_00036681 predicted 250
12 SASI_Hs01_00036682 predicted 693
13 SASI_Hs01_00036683 predicted 273
14 SASI_Hs01_00036685 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099794 predicted 1135
2 SASI_Rn02_00198568 predicted 506
3 SASI_Rn01_00099795 predicted 1204
4 SASI_Rn01_00099796 predicted 851
5 SASI_Rn01_00099798 predicted 942
6 SASI_Rn01_00099799 predicted 1147
7 SASI_Rn01_00099800 predicted 478
8 SASI_Rn02_00198569 predicted 891
9 SASI_Rn01_00099801 predicted 648
10 SASI_Rn01_00099802 predicted 758
11 SASI_Rn01_00099797 predicted 1126
12 SASI_Rn01_00099803 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104585 predicted 911
2 SASI_Mm01_00104586 predicted 711
3 SASI_Mm01_00104588 predicted 302
4 SASI_Mm01_00104589 predicted 808
5 SASI_Mm01_00104591 predicted 861
6 SASI_Mm02_00321698 predicted 209
7 SASI_Mm02_00321699 predicted 206
8 SASI_Mm02_00321700 predicted 915
9 SASI_Mm02_00321701 predicted 253
10 SASI_Mm02_00321702 predicted 457
11 SASI_Mm01_00104584 predicted 1157
12 SASI_Mm01_00104587 predicted 1159
13 SASI_Mm01_00104590 predicted 469
14 SASI_Mm01_00104592 predicted 1105
15 SASI_Mm01_00104593 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000231
SGCG MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000231.2-1414s21c1
Sequence:CCGGGTAGCCTTGCTCAGTACTAAACTCGAGTTTAGTACTGAGCAAGGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-684s1c1
Sequence:CCGGACCCGTTTCAAGACCTTAGATCTCGAGATCTAAGGTCTTGAAACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-433s1c1
Sequence:CCGGGCTGCTACAATCAACCCAGAACTCGAGTTCTGGGTTGATTGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000231.1-1458s1c1
Sequence:CCGGCCCTTCAGTTTAATGCAAGTACTCGAGTACTTGCATTAAACTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-686s1c1
Sequence:CCGGCCGTTTCAAGACCTTAGATTACTCGAGTAATCTAAGGTCTTGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-175s1c1
Sequence:CCGGGCCAGAGAATCAGTATGTCTACTCGAGTAGACATACTGATTCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000231.2-302s21c1
Sequence:CCGGGAATTTAGCTCTTACAATTTGCTCGAGCAAATTGTAAGAGCTAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000231.2-638s21c1
Sequence:CCGGTACAGATAAACTTCGAGTAACCTCGAGGTTACTCGAAGTTTATCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000231.2-1354s21c1
Sequence:CCGGAGTTGCCGTGTGGAGTTAATGCTCGAGCATTAACTCCACACGGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000231
SGCG MISSION shRNA shRNA Plasmid DNA
sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000231.2-1414s21c1
Sequence:CCGGGTAGCCTTGCTCAGTACTAAACTCGAGTTTAGTACTGAGCAAGGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-684s1c1
Sequence:CCGGACCCGTTTCAAGACCTTAGATCTCGAGATCTAAGGTCTTGAAACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-433s1c1
Sequence:CCGGGCTGCTACAATCAACCCAGAACTCGAGTTCTGGGTTGATTGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000231.1-1458s1c1
Sequence:CCGGCCCTTCAGTTTAATGCAAGTACTCGAGTACTTGCATTAAACTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-686s1c1
Sequence:CCGGCCGTTTCAAGACCTTAGATTACTCGAGTAATCTAAGGTCTTGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-175s1c1
Sequence:CCGGGCCAGAGAATCAGTATGTCTACTCGAGTAGACATACTGATTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000231.2-302s21c1
Sequence:CCGGGAATTTAGCTCTTACAATTTGCTCGAGCAAATTGTAAGAGCTAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000231.2-638s21c1
Sequence:CCGGTACAGATAAACTTCGAGTAACCTCGAGGTTACTCGAAGTTTATCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000231.2-1354s21c1
Sequence:CCGGAGTTGCCGTGTGGAGTTAATGCTCGAGCATTAACTCCACACGGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000231
SGCG MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000231.2-1414s21c1
Sequence:CCGGGTAGCCTTGCTCAGTACTAAACTCGAGTTTAGTACTGAGCAAGGCTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-684s1c1
Sequence:CCGGACCCGTTTCAAGACCTTAGATCTCGAGATCTAAGGTCTTGAAACGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-433s1c1
Sequence:CCGGGCTGCTACAATCAACCCAGAACTCGAGTTCTGGGTTGATTGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000231.1-1458s1c1
Sequence:CCGGCCCTTCAGTTTAATGCAAGTACTCGAGTACTTGCATTAAACTGAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-686s1c1
Sequence:CCGGCCGTTTCAAGACCTTAGATTACTCGAGTAATCTAAGGTCTTGAAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000231.1-175s1c1
Sequence:CCGGGCCAGAGAATCAGTATGTCTACTCGAGTAGACATACTGATTCTCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000231.2-302s21c1
Sequence:CCGGGAATTTAGCTCTTACAATTTGCTCGAGCAAATTGTAAGAGCTAAATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000231.2-638s21c1
Sequence:CCGGTACAGATAAACTTCGAGTAACCTCGAGGTTACTCGAAGTTTATCTGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000231.2-1354s21c1
Sequence:CCGGAGTTGCCGTGTGGAGTTAATGCTCGAGCATTAACTCCACACGGCAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011892
VALIDATED
SGCG MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-448s1c1
Sequence:CCGGCCCAATAGGAATGGGTCACTTCTCGAGAAGTGACCCATTCCTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-818s1c1
Sequence:CCGGCCATTTCAAGACCTTAGGTTACTCGAGTAACCTAAGGTCTTGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-813s1c1
Sequence:CCGGCTGACCCATTTCAAGACCTTACTCGAGTAAGGTCTTGAAATGGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-356s1c1
Sequence:CCGGCGCTGCCTATACCTATTCGTTCTCGAGAACGAATAGGTATAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-665s1c1
Sequence:CCGGAGCCAGCACTTTCAGATCAATCTCGAGATTGATCTGAAAGTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011892
VALIDATED
SGCG MISSION shRNA shRNA Plasmid DNA
sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-448s1c1
Sequence:CCGGCCCAATAGGAATGGGTCACTTCTCGAGAAGTGACCCATTCCTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-818s1c1
Sequence:CCGGCCATTTCAAGACCTTAGGTTACTCGAGTAACCTAAGGTCTTGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-813s1c1
Sequence:CCGGCTGACCCATTTCAAGACCTTACTCGAGTAAGGTCTTGAAATGGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-356s1c1
Sequence:CCGGCGCTGCCTATACCTATTCGTTCTCGAGAACGAATAGGTATAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-665s1c1
Sequence:CCGGAGCCAGCACTTTCAGATCAATCTCGAGATTGATCTGAAAGTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011892
VALIDATED
SGCG MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-448s1c1
Sequence:CCGGCCCAATAGGAATGGGTCACTTCTCGAGAAGTGACCCATTCCTATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-818s1c1
Sequence:CCGGCCATTTCAAGACCTTAGGTTACTCGAGTAACCTAAGGTCTTGAAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-813s1c1
Sequence:CCGGCTGACCCATTTCAAGACCTTACTCGAGTAAGGTCTTGAAATGGGTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-356s1c1
Sequence:CCGGCGCTGCCTATACCTATTCGTTCTCGAGAACGAATAGGTATAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011892.1-665s1c1
Sequence:CCGGAGCCAGCACTTTCAGATCAATCTCGAGATTGATCTGAAAGTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)