EMAIL THIS PAGE TO A FRIEND

SGCZ

sarcoglycan, zeta

86 Gene Product Result for
Synonyms: ZSG1
UniProtKB ID: Q96LD1, Q6REU0
Gene ID:
Human(137868) Summary: The zeta-sarcoglycan gene measures over 465 kb and localizes to 8p22. This protein is part of the sarcoglycan complex, a group of 6 proteins. The sarcoglycans are all N-glycosylated transmembrane proteins with a short intra-cellular domain, a single transmembrane region and a large extra-cellular domain containing a carboxyl-terminal cluster with several conserved cysteine residues. The sarcoglycan complex is part of the dystrophin-associated glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extra-cellular matrix. [provided by RefSeq, Jul 2008]
Mouse(244431) sarcoglycan zeta
Rat(364605) sarcoglycan zeta
domestic guinea pig(100727492) sarcoglycan, zeta
naked mole-rat(101713331) sarcoglycan, zeta
cow(616741) sarcoglycan, zeta
sheep(101122410) sarcoglycan, zeta
chicken(422739) sarcoglycan, zeta
domestic cat(101086054) sarcoglycan, zeta
dog(482890) sarcoglycan, zeta
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017585 Anti-SGCZ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011791 MISSION® esiRNA esiRNA targeting human SGCZ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139167 Rosetta Predictions human pricing
NM_001108875 Rosetta Predictions rat pricing
NM_145841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230789 predicted 773
2 SASI_Hs01_00230790 predicted 799
3 SASI_Hs01_00230791 predicted 873
4 SASI_Hs01_00230792 predicted 1552
5 SASI_Hs01_00230793 predicted 1414
6 SASI_Hs01_00230794 predicted 1005
7 SASI_Hs01_00230795 predicted 1247
8 SASI_Hs01_00230796 predicted 971
9 SASI_Hs01_00230797 predicted 1423
10 SASI_Hs01_00230798 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242945 predicted 563
2 SASI_Rn02_00242946 predicted 440
3 SASI_Rn02_00242947 predicted 342
4 SASI_Rn02_00242948 predicted 823
5 SASI_Rn02_00242949 predicted 484
6 SASI_Rn02_00242950 predicted 532
7 SASI_Rn02_00242951 predicted 511
8 SASI_Rn02_00242952 predicted 584
9 SASI_Rn02_00242953 predicted 445
10 SASI_Rn02_00242954 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341323 predicted 1019
2 SASI_Mm02_00341324 predicted 877
3 SASI_Mm02_00341325 predicted 962
4 SASI_Mm01_00144291 predicted 1050
5 SASI_Mm02_00341326 predicted 1672
6 SASI_Mm02_00341327 predicted 1525
7 SASI_Mm01_00144293 predicted 1028
8 SASI_Mm02_00341328 predicted 1099
9 SASI_Mm02_00341329 predicted 919
10 SASI_Mm02_00341330 predicted 1320
11 SASI_Mm01_00144284 predicted 332
12 SASI_Mm01_00144285 predicted 227
13 SASI_Mm01_00144286 predicted 390
14 SASI_Mm01_00144287 predicted 318
15 SASI_Mm01_00144288 predicted 397
16 SASI_Mm01_00144289 predicted 674
17 SASI_Mm01_00144290 predicted 316
18 SASI_Mm01_00144292 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139167
SGCZ MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, zeta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-89s1c1
Sequence:CCGGGATGGCGAAAGAGGTGCTTATCTCGAGATAAGCACCTCTTTCGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139167.1-1181s1c1
Sequence:CCGGGCGAAGTGAAGCACACAGTTTCTCGAGAAACTGTGTGCTTCACTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-569s1c1
Sequence:CCGGCCCAAGATCTCAGGCTTGAATCTCGAGATTCAAGCCTGAGATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139167.1-1155s1c1
Sequence:CCGGGAGAATAACATAGGTGCCTTTCTCGAGAAAGGCACCTATGTTATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-51s1c1
Sequence:CCGGGACTGAGAATGCACAACTTTACTCGAGTAAAGTTGTGCATTCTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-857s1c1
Sequence:CCGGGTTCCACTTGTCAGTCCAGTACTCGAGTACTGGACTGACAAGTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-230s1c1
Sequence:CCGGGAATCCGACTTGAAGGTATATCTCGAGATATACCTTCAAGTCGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139167
SGCZ MISSION shRNA shRNA Plasmid DNA
sarcoglycan, zeta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-89s1c1
Sequence:CCGGGATGGCGAAAGAGGTGCTTATCTCGAGATAAGCACCTCTTTCGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139167.1-1181s1c1
Sequence:CCGGGCGAAGTGAAGCACACAGTTTCTCGAGAAACTGTGTGCTTCACTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-569s1c1
Sequence:CCGGCCCAAGATCTCAGGCTTGAATCTCGAGATTCAAGCCTGAGATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139167.1-1155s1c1
Sequence:CCGGGAGAATAACATAGGTGCCTTTCTCGAGAAAGGCACCTATGTTATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-51s1c1
Sequence:CCGGGACTGAGAATGCACAACTTTACTCGAGTAAAGTTGTGCATTCTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-857s1c1
Sequence:CCGGGTTCCACTTGTCAGTCCAGTACTCGAGTACTGGACTGACAAGTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-230s1c1
Sequence:CCGGGAATCCGACTTGAAGGTATATCTCGAGATATACCTTCAAGTCGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139167
SGCZ MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, zeta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-89s1c1
Sequence:CCGGGATGGCGAAAGAGGTGCTTATCTCGAGATAAGCACCTCTTTCGCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139167.1-1181s1c1
Sequence:CCGGGCGAAGTGAAGCACACAGTTTCTCGAGAAACTGTGTGCTTCACTTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-569s1c1
Sequence:CCGGCCCAAGATCTCAGGCTTGAATCTCGAGATTCAAGCCTGAGATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139167.1-1155s1c1
Sequence:CCGGGAGAATAACATAGGTGCCTTTCTCGAGAAAGGCACCTATGTTATTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-51s1c1
Sequence:CCGGGACTGAGAATGCACAACTTTACTCGAGTAAAGTTGTGCATTCTCAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-857s1c1
Sequence:CCGGGTTCCACTTGTCAGTCCAGTACTCGAGTACTGGACTGACAAGTGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139167.1-230s1c1
Sequence:CCGGGAATCCGACTTGAAGGTATATCTCGAGATATACCTTCAAGTCGGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145841
SGCZ MISSION shRNA Bacterial Glycerol Stock
sarcoglycan, zeta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-734s1c1
Sequence:CCGGTGGGAAATCTACCAATCGGTTCTCGAGAACCGATTGGTAGATTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-129s1c1
Sequence:CCGGGTTGGTTACCATGATAGTTAACTCGAGTTAACTATCATGGTAACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-262s1c1
Sequence:CCGGCTACCATTGTATGTGAAAGAACTCGAGTTCTTTCACATACAATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-138s1c1
Sequence:CCGGCATGATAGTTAACTTAGCCATCTCGAGATGGCTAAGTTAACTATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-322s1c1
Sequence:CCGGGACAGAAATGTAACAGTGAATCTCGAGATTCACTGTTACATTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145841
SGCZ MISSION shRNA shRNA Plasmid DNA
sarcoglycan, zeta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-734s1c1
Sequence:CCGGTGGGAAATCTACCAATCGGTTCTCGAGAACCGATTGGTAGATTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-129s1c1
Sequence:CCGGGTTGGTTACCATGATAGTTAACTCGAGTTAACTATCATGGTAACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-262s1c1
Sequence:CCGGCTACCATTGTATGTGAAAGAACTCGAGTTCTTTCACATACAATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-138s1c1
Sequence:CCGGCATGATAGTTAACTTAGCCATCTCGAGATGGCTAAGTTAACTATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-322s1c1
Sequence:CCGGGACAGAAATGTAACAGTGAATCTCGAGATTCACTGTTACATTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145841
SGCZ MISSION shRNA Lentiviral Transduction Particles
sarcoglycan, zeta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-734s1c1
Sequence:CCGGTGGGAAATCTACCAATCGGTTCTCGAGAACCGATTGGTAGATTTCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-129s1c1
Sequence:CCGGGTTGGTTACCATGATAGTTAACTCGAGTTAACTATCATGGTAACCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-262s1c1
Sequence:CCGGCTACCATTGTATGTGAAAGAACTCGAGTTCTTTCACATACAATGGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-138s1c1
Sequence:CCGGCATGATAGTTAACTTAGCCATCTCGAGATGGCTAAGTTAACTATCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145841.1-322s1c1
Sequence:CCGGGACAGAAATGTAACAGTGAATCTCGAGATTCACTGTTACATTTCTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)