EMAIL THIS PAGE TO A FRIEND

SGIP1

SH3-domain GRB2-like (endophilin) interacting protein 1

130 Gene Product Result for
Gene ID:
Human(84251) Summary: SGIP1 functions as an endocytic protein that affects signaling by receptors in neuronal systems involved in energy homeostasis via its interaction with endophilins (see SH3GL3; MIM 603362) (Trevaskis et al., 2005 [PubMed 15919751]
Mouse(73094) SH3-domain GRB2-like (endophilin) interacting protein 1
Rat(313413) SH3-domain GRB2-like (endophilin) interacting protein 1
chicken(776038) SH3-domain GRB2-like (endophilin) interacting protein 1
Horse(100069364) SH3-domain GRB2-like (endophilin) interacting protein 1
domestic cat(101085907) SH3-domain GRB2-like (endophilin) interacting protein 1
dog(479539) SH3-domain GRB2-like (endophilin) interacting protein 1
cow(100139116) SH3-domain GRB2-like (endophilin) interacting protein 1
sheep(101112175) SH3-domain GRB2-like (endophilin) interacting protein 1
naked mole-rat(101702838) SH3-domain GRB2-like (endophilin) interacting protein 1
domestic guinea pig(100724711) SH3-domain GRB2-like (endophilin) interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032291 Rosetta Predictions human pricing
XM_001058167 Rosetta Predictions rat pricing
XM_233240 Rosetta Predictions rat pricing
NM_144906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063646 predicted 1806
2 SASI_Hs02_00359618 predicted 2053
3 SASI_Hs01_00063647 predicted 2283
4 SASI_Hs01_00063649 predicted 1977
5 SASI_Hs01_00063650 predicted 2790
6 SASI_Hs02_00359619 predicted 1723
7 SASI_Hs01_00063653 predicted 1643
8 SASI_Hs01_00063654 predicted 2715
9 SASI_Hs02_00359620 predicted 2181
10 SASI_Hs02_00359621 predicted 272
11 SASI_Hs01_00063648 predicted 410
12 SASI_Hs01_00063651 predicted 945
13 SASI_Hs01_00063652 predicted 1190
14 SASI_Hs01_00063655 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288815 predicted 1518
2 SASI_Rn02_00288816 predicted 783
3 SASI_Rn02_00288817 predicted 2299
4 SASI_Rn02_00288818 predicted 1845
5 SASI_Rn02_00288819 predicted 746
6 SASI_Rn02_00288820 predicted 2288
7 SASI_Rn02_00288821 predicted 2505
8 SASI_Rn02_00288822 predicted 1338
9 SASI_Rn02_00288823 predicted 748
10 SASI_Rn02_00288824 predicted 2086
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387542 predicted 1512
2 SASI_Rn02_00387543 predicted 789
3 SASI_Rn02_00387544 predicted 2300
4 SASI_Rn02_00387545 predicted 1845
5 SASI_Rn02_00387546 predicted 737
6 SASI_Rn02_00387547 predicted 2284
7 SASI_Rn02_00387548 predicted 2507
8 SASI_Rn02_00387549 predicted 1342
9 SASI_Rn02_00387550 predicted 750
10 SASI_Rn02_00387551 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175305 predicted 749
2 SASI_Mm02_00340378 predicted 2178
3 SASI_Mm01_00175306 predicted 1290
4 SASI_Mm01_00175307 predicted 511
5 SASI_Mm02_00340379 predicted 1968
6 SASI_Mm01_00175310 predicted 1615
7 SASI_Mm01_00175311 predicted 1114
8 SASI_Mm01_00175312 predicted 869
9 SASI_Mm01_00175313 predicted 1954
10 SASI_Mm01_00175314 predicted 1886
11 SASI_Mm01_00175308 predicted 355
12 SASI_Mm01_00175309 predicted 1697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032291
SGIP1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like (endophilin) interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-2417s1c1
Sequence:CCGGCCCAAGCAAACCTTCTCCATTCTCGAGAATGGAGAAGGTTTGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-890s21c1
Sequence:CCGGGGTTCAGGCCAACCAATTAATCTCGAGATTAATTGGTTGGCCTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032291.1-3368s1c1
Sequence:CCGGCCCTCTCTACAGTTTCGCAAACTCGAGTTTGCGAAACTGTAGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-785s1c1
Sequence:CCGGGCCAAAGTTAACAAGGCCTTTCTCGAGAAAGGCCTTGTTAACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-1811s1c1
Sequence:CCGGCCCAAGCAAATGTATCGTTAACTCGAGTTAACGATACATTTGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-1227s1c1
Sequence:CCGGGCTGAGCAGACCTTCATTAAACTCGAGTTTAATGAAGGTCTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-2633s21c1
Sequence:CCGGGTTGGAGCAGGGTATCGATTTCTCGAGAAATCGATACCCTGCTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032291.2-2798s21c1
Sequence:CCGGTATCTGCACTTGGGATATATCCTCGAGGATATATCCCAAGTGCAGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-1325s21c1
Sequence:CCGGGTACTATCGCCGCTCAATTTACTCGAGTAAATTGAGCGGCGATAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032291
SGIP1 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like (endophilin) interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-2417s1c1
Sequence:CCGGCCCAAGCAAACCTTCTCCATTCTCGAGAATGGAGAAGGTTTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-890s21c1
Sequence:CCGGGGTTCAGGCCAACCAATTAATCTCGAGATTAATTGGTTGGCCTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032291.1-3368s1c1
Sequence:CCGGCCCTCTCTACAGTTTCGCAAACTCGAGTTTGCGAAACTGTAGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-785s1c1
Sequence:CCGGGCCAAAGTTAACAAGGCCTTTCTCGAGAAAGGCCTTGTTAACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-1811s1c1
Sequence:CCGGCCCAAGCAAATGTATCGTTAACTCGAGTTAACGATACATTTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-1227s1c1
Sequence:CCGGGCTGAGCAGACCTTCATTAAACTCGAGTTTAATGAAGGTCTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-2633s21c1
Sequence:CCGGGTTGGAGCAGGGTATCGATTTCTCGAGAAATCGATACCCTGCTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032291.2-2798s21c1
Sequence:CCGGTATCTGCACTTGGGATATATCCTCGAGGATATATCCCAAGTGCAGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-1325s21c1
Sequence:CCGGGTACTATCGCCGCTCAATTTACTCGAGTAAATTGAGCGGCGATAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032291
SGIP1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like (endophilin) interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-2417s1c1
Sequence:CCGGCCCAAGCAAACCTTCTCCATTCTCGAGAATGGAGAAGGTTTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-890s21c1
Sequence:CCGGGGTTCAGGCCAACCAATTAATCTCGAGATTAATTGGTTGGCCTGAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032291.1-3368s1c1
Sequence:CCGGCCCTCTCTACAGTTTCGCAAACTCGAGTTTGCGAAACTGTAGAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-785s1c1
Sequence:CCGGGCCAAAGTTAACAAGGCCTTTCTCGAGAAAGGCCTTGTTAACTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-1811s1c1
Sequence:CCGGCCCAAGCAAATGTATCGTTAACTCGAGTTAACGATACATTTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032291.1-1227s1c1
Sequence:CCGGGCTGAGCAGACCTTCATTAAACTCGAGTTTAATGAAGGTCTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-2633s21c1
Sequence:CCGGGTTGGAGCAGGGTATCGATTTCTCGAGAAATCGATACCCTGCTCCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032291.2-2798s21c1
Sequence:CCGGTATCTGCACTTGGGATATATCCTCGAGGATATATCCCAAGTGCAGATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032291.2-1325s21c1
Sequence:CCGGGTACTATCGCCGCTCAATTTACTCGAGTAAATTGAGCGGCGATAGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144906
VALIDATED
SGIP1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain GRB2-like (endophilin) interacting protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144906.1-3134s1c1
Sequence:CCGGGCTTCAGTTTAGTGGGTTAAACTCGAGTTTAACCCACTAAACTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-2432s1c1
Sequence:CCGGGGTTCTTTACTGGCGAGATTTCTCGAGAAATCTCGCCAGTAAAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144906.1-227s1c1
Sequence:CCGGGCCTTTGGAATACGGAAGAAACTCGAGTTTCTTCCGTATTCCAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144906.1-3563s1c1
Sequence:CCGGCCTTGTTTCTTCTTTACTCATCTCGAGATGAGTAAAGAAGAAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-2011s1c1
Sequence:CCGGCCAACTTCTCTGCTGTGATAACTCGAGTTATCACAGCAGAGAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-1094s1c1
Sequence:CCGGCCCAAGTCTGTTGCTGTTAATCTCGAGATTAACAGCAACAGACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144906
VALIDATED
SGIP1 MISSION shRNA shRNA Plasmid DNA
SH3-domain GRB2-like (endophilin) interacting protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144906.1-3134s1c1
Sequence:CCGGGCTTCAGTTTAGTGGGTTAAACTCGAGTTTAACCCACTAAACTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-2432s1c1
Sequence:CCGGGGTTCTTTACTGGCGAGATTTCTCGAGAAATCTCGCCAGTAAAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144906.1-227s1c1
Sequence:CCGGGCCTTTGGAATACGGAAGAAACTCGAGTTTCTTCCGTATTCCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144906.1-3563s1c1
Sequence:CCGGCCTTGTTTCTTCTTTACTCATCTCGAGATGAGTAAAGAAGAAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-2011s1c1
Sequence:CCGGCCAACTTCTCTGCTGTGATAACTCGAGTTATCACAGCAGAGAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-1094s1c1
Sequence:CCGGCCCAAGTCTGTTGCTGTTAATCTCGAGATTAACAGCAACAGACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144906
VALIDATED
SGIP1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain GRB2-like (endophilin) interacting protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144906.1-3134s1c1
Sequence:CCGGGCTTCAGTTTAGTGGGTTAAACTCGAGTTTAACCCACTAAACTGAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-2432s1c1
Sequence:CCGGGGTTCTTTACTGGCGAGATTTCTCGAGAAATCTCGCCAGTAAAGAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144906.1-227s1c1
Sequence:CCGGGCCTTTGGAATACGGAAGAAACTCGAGTTTCTTCCGTATTCCAAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144906.1-3563s1c1
Sequence:CCGGCCTTGTTTCTTCTTTACTCATCTCGAGATGAGTAAAGAAGAAACAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-2011s1c1
Sequence:CCGGCCAACTTCTCTGCTGTGATAACTCGAGTTATCACAGCAGAGAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144906.1-1094s1c1
Sequence:CCGGCCCAAGTCTGTTGCTGTTAATCTCGAGATTAACAGCAACAGACTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)