EMAIL THIS PAGE TO A FRIEND

SGK1

serum/glucocorticoid regulated kinase 1

153 Gene Product Result for
Synonyms: SGK
Gene ID:
Human(6446) Summary: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. High levels of expression of this gene may contribute to conditions such as hypertension and diabetic nephropathy. Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
Mouse(20393) serum/glucocorticoid regulated kinase 1
Rat(29517) serum/glucocorticoid regulated kinase 1
Zebrafish(324140) serum/glucocorticoid regulated kinase 1
chicken(395133) serum/glucocorticoid regulated kinase 1
domestic cat(101098954) serum/glucocorticoid regulated kinase 1
dog(403647) serum/glucocorticoid regulated kinase 1
domestic guinea pig(100720058) serum/glucocorticoid regulated kinase 1
naked mole-rat(101708117) serum/glucocorticoid regulated kinase 1
Domestic Rabbit(100008723) serum/glucocorticoid regulated kinase 1
cow(515854) serum/glucocorticoid regulated kinase 1
sheep(101107709) serum/glucocorticoid regulated kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503834 Anti-phospho-SGK (pSer422) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504066 Anti-phospho-SGK (pSer78) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
36-002 Anti-phospho-SGK Antibody Anti-phospho-SGK Antibody is an antibody against phospho-SGK for use in WB. human
western blot pricing
GW21987A Anti-SGK (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
GW21987B Anti-SGK (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB1411782 ANTI-SGK antibody produced in mouse clone 3C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411792 ANTI-SGK antibody produced in mouse clone 1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
S5188 Anti-SGK antibody produced in rabbit buffered aqueous solution, IgG fraction of antiserum human
immunofluorescence, microarray, western blot pricing
SAB4502765 Anti-SGK antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502764 Anti-SGK, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
07-315 Anti-SGK1 Antibody This Anti-SGK1 Antibody is validated for use in IP, WB for the detection of SGK1. human, rat
immunoprecipitation (IP), western blot pricing
HPA051251 Anti-SGK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2108342 Anti-SGK1 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, rat, human, horse, mouse, rabbit, dog
immunohistochemistry, western blot pricing
MABS1476 Anti-SGK1 Antibody, clone 1G2.1 Detect SGK1 using this mouse monoclonal Anti-SGK1 Antibody, clone 1G2.1, Cat. No. MABS1476, validated for use in Immunohistochemistry (Paraffin) and Western Blotting. This Anti-mTOR Antibody, clone F11 is validated for use in WB, IP for the detection of mTOR. mouse, human, rat, rat, mouse, human
immunohistochemistry, western blot pricing
SAB2104902 Anti-SGK1, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, rabbit, human, rat, mouse
western blot pricing
WH0006446M1 Monoclonal Anti-SGK antibody produced in mouse clone 4D7-G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005627 Rosetta Predictions human pricing
NM_019232 Rosetta Predictions rat pricing
NM_011361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339955 predicted 1169
2 SASI_Hs01_00045271 predicted 827
3 SASI_Hs01_00045272 predicted 593
4 SASI_Hs01_00045273 predicted 992
5 SASI_Hs01_00045274 predicted 1120
6 SASI_Hs01_00045275 predicted 354
7 SASI_Hs01_00045276 predicted 1165
8 SASI_Hs01_00045278 predicted 1124
9 SASI_Hs02_00339956 predicted 951
10 SASI_Hs02_00339957 predicted 417
11 SASI_Hs01_00045269 predicted 442
12 SASI_Hs01_00045270 predicted 349
13 SASI_Hs01_00045277 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040042 predicted 1051
2 SASI_Rn01_00040043 predicted 1154
3 SASI_Rn01_00040044 predicted 789
4 SASI_Rn01_00040045 predicted 1390
5 SASI_Rn01_00040046 predicted 607
6 SASI_Rn01_00040047 predicted 1329
7 SASI_Rn02_00262098 predicted 291
8 SASI_Rn02_00262099 predicted 447
9 SASI_Rn01_00040048 predicted 660
10 SASI_Rn01_00040049 predicted 372
11 SASI_Rn01_00040050 predicted 455
12 SASI_Rn01_00040051 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139197 predicted 1215
2 SASI_Mm01_00139198 predicted 424
3 SASI_Mm01_00139199 predicted 1097
4 SASI_Mm02_00320518 predicted 1145
5 SASI_Mm01_00139201 predicted 198
6 SASI_Mm01_00139202 predicted 529
7 SASI_Mm01_00139203 predicted 659
8 SASI_Mm01_00139204 predicted 877
9 SASI_Mm01_00139205 predicted 693
10 SASI_Mm01_00139206 predicted 1280
11 SASI_Mm01_00139200 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005627
VALIDATED
SGK1 MISSION shRNA Bacterial Glycerol Stock
serum/glucocorticoid regulated kinase 1
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-284s21c1
Sequence:CCGGGCCTGAGCTTATGAATGCCAACTCGAGTTGGCATTCATAAGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005627.3-1510s21c1
Sequence:CCGGGCAATCTTATTGCACACTGTTCTCGAGAACAGTGTGCAATAAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005627.3-1499s21c1
Sequence:CCGGCTGGAAGCTTAGCAATCTTATCTCGAGATAAGATTGCTAAGCTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1467s1c1
Sequence:CCGGCTGGAAGCTTAGCAATCTTATCTCGAGATAAGATTGCTAAGCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1300s1c1
Sequence:CCGGGCCGAGGCTTTCCTAGGCTTTCTCGAGAAAGCCTAGGAAAGCCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-320s1c1
Sequence:CCGGCGTCCAATCCTCATGCTAAACCTCGAGGTTTAGCATGAGGATTGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-154s21c1
Sequence:CCGGCAATTCTCATCGCTTTCATGACTCGAGTCATGAAAGCGATGAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1192s1c1
Sequence:CCGGCCCAACGACCTACGGCACTTTCTCGAGAAAGTGCCGTAGGTCGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040173    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_005627.2-2294s1c1
Sequence:CCGGCCTCATCCCATCACACAACTTCTCGAGAAGTTGTGTGATGGGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-964s1c1
Sequence:CCGGGCTGAAATGTACGACAACATTCTCGAGAATGTTGTCGTACATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-252s1c1
Sequence:CCGGGCCTGAGCTTATGAATGCCAACTCGAGTTGGCATTCATAAGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1111s1c1
Sequence:CCGGCATGTCTTCTTCTCCTTAATTCTCGAGAATTAAGGAGAAGAAGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-496s1c1
Sequence:CCGGCGGAATGTTCTGTTGAAGAATCTCGAGATTCTTCAACAGAACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-730s21c1
Sequence:CCGGATTCACTGAACATCGTTTATACTCGAGTATAAACGATGTTCAGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1478s1c1
Sequence:CCGGGCAATCTTATTGCACACTGTTCTCGAGAACAGTGTGCAATAAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1087s1c1
Sequence:CCGGGATGACTTCATGGAGATTAAGCTCGAGCTTAATCTCCATGAAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005627.2-1972s1c1
Sequence:CCGGGTCTTGCAATGACTCGTATTCCTCGAGGAATACGAGTCATTGCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.x-107s1c1
Sequence:CCGGCAATTCTCATCGCTTTCATGACTCGAGTCATGAAAGCGATGAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.x-952s1c1
Sequence:CCGGAAATGTACGACAACATTCTGCTCGAGCAGAATGTTGTCGTACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.x-1369s1c1
Sequence:CCGGTATGTGTGTTTCCGAATGTTTCTCGAGAAACATTCGGAAACACACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005627
VALIDATED
SGK1 MISSION shRNA shRNA Plasmid DNA
serum/glucocorticoid regulated kinase 1
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-284s21c1
Sequence:CCGGGCCTGAGCTTATGAATGCCAACTCGAGTTGGCATTCATAAGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005627.3-1510s21c1
Sequence:CCGGGCAATCTTATTGCACACTGTTCTCGAGAACAGTGTGCAATAAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005627.3-1499s21c1
Sequence:CCGGCTGGAAGCTTAGCAATCTTATCTCGAGATAAGATTGCTAAGCTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1467s1c1
Sequence:CCGGCTGGAAGCTTAGCAATCTTATCTCGAGATAAGATTGCTAAGCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1300s1c1
Sequence:CCGGGCCGAGGCTTTCCTAGGCTTTCTCGAGAAAGCCTAGGAAAGCCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-320s1c1
Sequence:CCGGCGTCCAATCCTCATGCTAAACCTCGAGGTTTAGCATGAGGATTGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-154s21c1
Sequence:CCGGCAATTCTCATCGCTTTCATGACTCGAGTCATGAAAGCGATGAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1192s1c1
Sequence:CCGGCCCAACGACCTACGGCACTTTCTCGAGAAAGTGCCGTAGGTCGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040173    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_005627.2-2294s1c1
Sequence:CCGGCCTCATCCCATCACACAACTTCTCGAGAAGTTGTGTGATGGGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-964s1c1
Sequence:CCGGGCTGAAATGTACGACAACATTCTCGAGAATGTTGTCGTACATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-252s1c1
Sequence:CCGGGCCTGAGCTTATGAATGCCAACTCGAGTTGGCATTCATAAGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1111s1c1
Sequence:CCGGCATGTCTTCTTCTCCTTAATTCTCGAGAATTAAGGAGAAGAAGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-496s1c1
Sequence:CCGGCGGAATGTTCTGTTGAAGAATCTCGAGATTCTTCAACAGAACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-730s21c1
Sequence:CCGGATTCACTGAACATCGTTTATACTCGAGTATAAACGATGTTCAGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1478s1c1
Sequence:CCGGGCAATCTTATTGCACACTGTTCTCGAGAACAGTGTGCAATAAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1087s1c1
Sequence:CCGGGATGACTTCATGGAGATTAAGCTCGAGCTTAATCTCCATGAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005627.2-1972s1c1
Sequence:CCGGGTCTTGCAATGACTCGTATTCCTCGAGGAATACGAGTCATTGCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.x-107s1c1
Sequence:CCGGCAATTCTCATCGCTTTCATGACTCGAGTCATGAAAGCGATGAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.x-952s1c1
Sequence:CCGGAAATGTACGACAACATTCTGCTCGAGCAGAATGTTGTCGTACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.x-1369s1c1
Sequence:CCGGTATGTGTGTTTCCGAATGTTTCTCGAGAAACATTCGGAAACACACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005627
VALIDATED
SGK1 MISSION shRNA Lentiviral Transduction Particles
serum/glucocorticoid regulated kinase 1
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-284s21c1
Sequence:CCGGGCCTGAGCTTATGAATGCCAACTCGAGTTGGCATTCATAAGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005627.3-1510s21c1
Sequence:CCGGGCAATCTTATTGCACACTGTTCTCGAGAACAGTGTGCAATAAGATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005627.3-1499s21c1
Sequence:CCGGCTGGAAGCTTAGCAATCTTATCTCGAGATAAGATTGCTAAGCTTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1467s1c1
Sequence:CCGGCTGGAAGCTTAGCAATCTTATCTCGAGATAAGATTGCTAAGCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1300s1c1
Sequence:CCGGGCCGAGGCTTTCCTAGGCTTTCTCGAGAAAGCCTAGGAAAGCCTCGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-320s1c1
Sequence:CCGGCGTCCAATCCTCATGCTAAACCTCGAGGTTTAGCATGAGGATTGGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-154s21c1
Sequence:CCGGCAATTCTCATCGCTTTCATGACTCGAGTCATGAAAGCGATGAGAATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1192s1c1
Sequence:CCGGCCCAACGACCTACGGCACTTTCTCGAGAAAGTGCCGTAGGTCGTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040173    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_005627.2-2294s1c1
Sequence:CCGGCCTCATCCCATCACACAACTTCTCGAGAAGTTGTGTGATGGGATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-964s1c1
Sequence:CCGGGCTGAAATGTACGACAACATTCTCGAGAATGTTGTCGTACATTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-252s1c1
Sequence:CCGGGCCTGAGCTTATGAATGCCAACTCGAGTTGGCATTCATAAGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1111s1c1
Sequence:CCGGCATGTCTTCTTCTCCTTAATTCTCGAGAATTAAGGAGAAGAAGACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-496s1c1
Sequence:CCGGCGGAATGTTCTGTTGAAGAATCTCGAGATTCTTCAACAGAACATTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005627.3-730s21c1
Sequence:CCGGATTCACTGAACATCGTTTATACTCGAGTATAAACGATGTTCAGTGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.2-1478s1c1
Sequence:CCGGGCAATCTTATTGCACACTGTTCTCGAGAACAGTGTGCAATAAGATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.2-1087s1c1
Sequence:CCGGGATGACTTCATGGAGATTAAGCTCGAGCTTAATCTCCATGAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005627.2-1972s1c1
Sequence:CCGGGTCTTGCAATGACTCGTATTCCTCGAGGAATACGAGTCATTGCAAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.x-107s1c1
Sequence:CCGGCAATTCTCATCGCTTTCATGACTCGAGTCATGAAAGCGATGAGAATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005627.x-952s1c1
Sequence:CCGGAAATGTACGACAACATTCTGCTCGAGCAGAATGTTGTCGTACATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005627.x-1369s1c1
Sequence:CCGGTATGTGTGTTTCCGAATGTTTCTCGAGAAACATTCGGAAACACACATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011361
VALIDATED
SGK1 MISSION shRNA Bacterial Glycerol Stock
serum/glucocorticoid regulated kinase 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011361.1-1146s21c1
Sequence:CCGGTGGGATGATCTCATCAATAAGCTCGAGCTTATTGATGAGATCATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011361.1-709s21c1
Sequence:CCGGACTCCCTAAACATCGTTTATACTCGAGTATAAACGATGTTTAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011361.1-2254s21c1
Sequence:CCGGGTCTGTACATTGGGTTATAACCTCGAGGTTATAACCCAATGTACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011361.1-1108s21c1
Sequence:CCGGTGGAGATTAAGAGTCATATTTCTCGAGAAATATGACTCTTAATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011361.1-1215s1c1
Sequence:CCGGCGGCACTTTGATCCCGAGTTTCTCGAGAAACTCGGGATCAAAGTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011361.1-973s1c1
Sequence:CCGGCGGCTGAGATGTACGACAATACTCGAGTATTGTCGTACATCTCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011361
VALIDATED
SGK1 MISSION shRNA shRNA Plasmid DNA
serum/glucocorticoid regulated kinase 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011361.1-1146s21c1
Sequence:CCGGTGGGATGATCTCATCAATAAGCTCGAGCTTATTGATGAGATCATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011361.1-709s21c1
Sequence:CCGGACTCCCTAAACATCGTTTATACTCGAGTATAAACGATGTTTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011361.1-2254s21c1
Sequence:CCGGGTCTGTACATTGGGTTATAACCTCGAGGTTATAACCCAATGTACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011361.1-1108s21c1
Sequence:CCGGTGGAGATTAAGAGTCATATTTCTCGAGAAATATGACTCTTAATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011361.1-1215s1c1
Sequence:CCGGCGGCACTTTGATCCCGAGTTTCTCGAGAAACTCGGGATCAAAGTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011361.1-973s1c1
Sequence:CCGGCGGCTGAGATGTACGACAATACTCGAGTATTGTCGTACATCTCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011361
VALIDATED
SGK1 MISSION shRNA Lentiviral Transduction Particles
serum/glucocorticoid regulated kinase 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011361.1-1146s21c1
Sequence:CCGGTGGGATGATCTCATCAATAAGCTCGAGCTTATTGATGAGATCATCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011361.1-709s21c1
Sequence:CCGGACTCCCTAAACATCGTTTATACTCGAGTATAAACGATGTTTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011361.1-2254s21c1
Sequence:CCGGGTCTGTACATTGGGTTATAACCTCGAGGTTATAACCCAATGTACAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011361.1-1108s21c1
Sequence:CCGGTGGAGATTAAGAGTCATATTTCTCGAGAAATATGACTCTTAATCTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011361.1-1215s1c1
Sequence:CCGGCGGCACTTTGATCCCGAGTTTCTCGAGAAACTCGGGATCAAAGTGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011361.1-973s1c1
Sequence:CCGGCGGCTGAGATGTACGACAATACTCGAGTATTGTCGTACATCTCAGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)