EMAIL THIS PAGE TO A FRIEND

SGK2

serum/glucocorticoid regulated kinase 2

83 Gene Product Result for
Synonyms: H-SGK2 dJ138B7.2
UniProtKB ID: Q9HBY8, Q52PK5, Q5H8Y6, Q5H8Z1, Q5TZR3, Q9UKG6
Gene ID:
Human(10110) Summary: This gene encodes a serine/threonine protein kinase. Although this gene product is similar to serum- and glucocorticoid-induced protein kinase (SGK), this gene is not induced by serum or glucocorticoids. This gene is induced in response to signals that activate phosphatidylinositol 3-kinase, which is also true for SGK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Mouse(27219) serum/glucocorticoid regulated kinase 2
Rat(171497) serum/glucocorticoid regulated kinase 2
domestic guinea pig(100719215) serum/glucocorticoid regulated kinase 2
naked mole-rat(101717022) serum/glucocorticoid regulated kinase 2
cow(517909) serum/glucocorticoid regulated kinase 2
sheep(101107121) serum/glucocorticoid regulated kinase 2
chicken(419166) serum/glucocorticoid regulated kinase 2
domestic cat(101095733) serum/glucocorticoid regulated kinase 2
dog(610835) serum/glucocorticoid regulated kinase family, member 3
Horse(100147213) serum/glucocorticoid regulated kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406925 Anti-SGK2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA011387 Anti-SGK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB1410063 Anti-SGK2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA008859 Anti-SGK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0010110M2 Monoclonal Anti-SGK2 antibody produced in mouse clone 1A7, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1408718 Monoclonal Anti-SGK2 antibody produced in mouse clone 3D2, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing
SAB1408719 Monoclonal Anti-SGK2 antibody produced in mouse clone 7C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1408720 Monoclonal Anti-SGK2 antibody produced in mouse clone 4G4, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1408721 Monoclonal Anti-SGK2 antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1408722 Monoclonal Anti-SGK2 antibody produced in mouse clone 1G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1408723 Monoclonal Anti-SGK2 antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170693 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
12-555 Crosstide KK Crosstide KK primarily used in Kinase Assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016276 Rosetta Predictions human pricing
NM_170693 Rosetta Predictions human pricing
XM_001070075 Rosetta Predictions rat pricing
XM_342570 Rosetta Predictions rat pricing
NM_013731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094921 predicted 990
2 SASI_Hs01_00094922 predicted 1096
3 SASI_Hs01_00094924 predicted 1015
4 SASI_Hs01_00094925 predicted 1107
5 SASI_Hs01_00094926 predicted 647
6 SASI_Hs01_00094927 predicted 567
7 SASI_Hs01_00094928 predicted 577
8 SASI_Hs01_00094930 predicted 1009
9 SASI_Hs02_00349189 predicted 1237
10 SASI_Hs02_00349190 predicted 718
11 SASI_Hs01_00094923 predicted 1095
12 SASI_Hs01_00094929 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013794 predicted 726
2 SASI_Hs01_00013795 predicted 826
3 SASI_Hs01_00013797 predicted 748
4 SASI_Hs01_00013798 predicted 841
5 SASI_Hs01_00013799 predicted 385
6 SASI_Hs01_00013800 predicted 311
7 SASI_Hs01_00013801 predicted 318
8 SASI_Hs01_00013803 predicted 742
9 SASI_Hs02_00367624 predicted 970
10 SASI_Hs02_00367625 predicted 454
11 SASI_Hs01_00013796 predicted 838
12 SASI_Hs01_00013802 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330357 predicted 1142
2 SASI_Rn02_00330358 predicted 521
3 SASI_Rn02_00330359 predicted 324
4 SASI_Rn02_00330360 predicted 324
5 SASI_Rn02_00330361 predicted 1395
6 SASI_Rn02_00330362 predicted 234
7 SASI_Rn02_00330363 predicted 835
8 SASI_Rn02_00330364 predicted 440
9 SASI_Rn02_00330365 predicted 1151
10 SASI_Rn02_00330366 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394489 predicted 1528
2 SASI_Rn02_00394490 predicted 1530
3 SASI_Rn02_00394491 predicted 1536
4 SASI_Rn02_00394492 predicted 1638
5 SASI_Rn02_00394493 predicted 1636
6 SASI_Rn02_00394494 predicted 1611
7 SASI_Rn02_00394495 predicted 1551
8 SASI_Rn02_00394496 predicted 1419
9 SASI_Rn02_00394497 predicted 1496
10 SASI_Rn02_00394498 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151372 predicted 417
2 SASI_Mm01_00151373 predicted 1301
3 SASI_Mm01_00151374 predicted 1177
4 SASI_Mm02_00322665 predicted 845
5 SASI_Mm01_00151376 predicted 822
6 SASI_Mm01_00151377 predicted 638
7 SASI_Mm01_00151378 predicted 1027
8 SASI_Mm01_00151379 predicted 443
9 SASI_Mm01_00151380 predicted 639
10 SASI_Mm01_00151381 predicted 401
11 SASI_Mm01_00151375 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013731
SGK2 MISSION shRNA Bacterial Glycerol Stock
serum/glucocorticoid regulated kinase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-1392s1c1
Sequence:CCGGGCACAGGATGATGATGACATTCTCGAGAATGTCATCATCATCCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-1266s1c1
Sequence:CCGGCCTGCTGACTTGAAACACTTTCTCGAGAAAGTGTTTCAAGTCAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-924s1c1
Sequence:CCGGGCTCCAGAAGTGCTTCGTAAACTCGAGTTTACGAAGCACTTCTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-767s1c1
Sequence:CCGGCCTTCACTCTCTCAACATCATCTCGAGATGATGTTGAGAGAGTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-645s1c1
Sequence:CCGGCTCTACTTTGTGCTTGACTATCTCGAGATAGTCAAGCACAAAGTAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-711s21c1
Sequence:CCGGTCTACTTTGTGCTTGACTATGCTCGAGCATAGTCAAGCACAAAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-1253s21c1
Sequence:CCGGATGTTCTTCAGTCCCATAAACCTCGAGGTTTATGGGACTGAAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-898s21c1
Sequence:CCGGTCACGTGGTACTGACCGATTTCTCGAGAAATCGGTCAGTACCACGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013731
SGK2 MISSION shRNA shRNA Plasmid DNA
serum/glucocorticoid regulated kinase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-1392s1c1
Sequence:CCGGGCACAGGATGATGATGACATTCTCGAGAATGTCATCATCATCCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-1266s1c1
Sequence:CCGGCCTGCTGACTTGAAACACTTTCTCGAGAAAGTGTTTCAAGTCAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-924s1c1
Sequence:CCGGGCTCCAGAAGTGCTTCGTAAACTCGAGTTTACGAAGCACTTCTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-767s1c1
Sequence:CCGGCCTTCACTCTCTCAACATCATCTCGAGATGATGTTGAGAGAGTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-645s1c1
Sequence:CCGGCTCTACTTTGTGCTTGACTATCTCGAGATAGTCAAGCACAAAGTAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-711s21c1
Sequence:CCGGTCTACTTTGTGCTTGACTATGCTCGAGCATAGTCAAGCACAAAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-1253s21c1
Sequence:CCGGATGTTCTTCAGTCCCATAAACCTCGAGGTTTATGGGACTGAAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-898s21c1
Sequence:CCGGTCACGTGGTACTGACCGATTTCTCGAGAAATCGGTCAGTACCACGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013731
SGK2 MISSION shRNA Lentiviral Transduction Particles
serum/glucocorticoid regulated kinase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-1392s1c1
Sequence:CCGGGCACAGGATGATGATGACATTCTCGAGAATGTCATCATCATCCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-1266s1c1
Sequence:CCGGCCTGCTGACTTGAAACACTTTCTCGAGAAAGTGTTTCAAGTCAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-924s1c1
Sequence:CCGGGCTCCAGAAGTGCTTCGTAAACTCGAGTTTACGAAGCACTTCTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-767s1c1
Sequence:CCGGCCTTCACTCTCTCAACATCATCTCGAGATGATGTTGAGAGAGTGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013731.1-645s1c1
Sequence:CCGGCTCTACTTTGTGCTTGACTATCTCGAGATAGTCAAGCACAAAGTAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-711s21c1
Sequence:CCGGTCTACTTTGTGCTTGACTATGCTCGAGCATAGTCAAGCACAAAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-1253s21c1
Sequence:CCGGATGTTCTTCAGTCCCATAAACCTCGAGGTTTATGGGACTGAAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013731.2-898s21c1
Sequence:CCGGTCACGTGGTACTGACCGATTTCTCGAGAAATCGGTCAGTACCACGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170693
VALIDATED
SGK2 MISSION shRNA Bacterial Glycerol Stock
serum/glucocorticoid regulated kinase 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.x-1181s1c1
Sequence:CCGGCTCAAGTGCATTCCTGGGATTCTCGAGAATCCCAGGAATGCACTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-1648s1c1
Sequence:CCGGGCTGGGAGATGTGGCTTATTTCTCGAGAAATAAGCCACATCTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-587s1c1
Sequence:CCGGGCACTCCCTCAACATCATTTACTCGAGTAAATGATGTTGAGGGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-1053s1c1
Sequence:CCGGACTCCACCCTTCAACCCAAATCTCGAGATTTGGGTTGAAGGGTGGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-698s1c1
Sequence:CCGGTGAAGACACCACATCCACATTCTCGAGAATGTGGATGTGGTGTCTTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-1336s21c1
Sequence:CCGGCAACGAGAAGCAGGTTTATTTCTCGAGAAATAAACCTGCTTCTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-698s21c1
Sequence:CCGGTGAAGACACCACATCCACATTCTCGAGAATGTGGATGTGGTGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-741s1c1
Sequence:CCGGGCACCTGAAGTGCTTCGGAAACTCGAGTTTCCGAAGCACTTCAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170693.1-1336s1c1
Sequence:CCGGCAACGAGAAGCAGGTTTATTTCTCGAGAAATAAACCTGCTTCTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-1218s1c1
Sequence:CCGGGATGATGACATCTTGGATTGCCTCGAGGCAATCCAAGATGTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.1-1702s1c1
Sequence:CCGGGTTCTGACACTAAGACATTAGCTCGAGCTAATGTCTTAGTGTCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-230s1c1
Sequence:CCGGGCCCACGGACTTCGACTTCCTCTCGAGAGGAAGTCGAAGTCCGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-729s1c1
Sequence:CCGGCCTGAGTACTTGGCACCTGAACTCGAGTTCAGGTGCCAAGTACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170693.1-463s21c1
Sequence:CCGGTCTACTTCGTGCTCGACTATGCTCGAGCATAGTCGAGCACGAAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-650s21c1
Sequence:CCGGACACGTGGTGCTGACGGATTTCTCGAGAAATCCGTCAGCACCACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-587s21c1
Sequence:CCGGGCACTCCCTCAACATCATTTACTCGAGTAAATGATGTTGAGGGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170693
VALIDATED
SGK2 MISSION shRNA shRNA Plasmid DNA
serum/glucocorticoid regulated kinase 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.x-1181s1c1
Sequence:CCGGCTCAAGTGCATTCCTGGGATTCTCGAGAATCCCAGGAATGCACTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-1648s1c1
Sequence:CCGGGCTGGGAGATGTGGCTTATTTCTCGAGAAATAAGCCACATCTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-587s1c1
Sequence:CCGGGCACTCCCTCAACATCATTTACTCGAGTAAATGATGTTGAGGGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-1053s1c1
Sequence:CCGGACTCCACCCTTCAACCCAAATCTCGAGATTTGGGTTGAAGGGTGGAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-698s1c1
Sequence:CCGGTGAAGACACCACATCCACATTCTCGAGAATGTGGATGTGGTGTCTTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-1336s21c1
Sequence:CCGGCAACGAGAAGCAGGTTTATTTCTCGAGAAATAAACCTGCTTCTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-698s21c1
Sequence:CCGGTGAAGACACCACATCCACATTCTCGAGAATGTGGATGTGGTGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-741s1c1
Sequence:CCGGGCACCTGAAGTGCTTCGGAAACTCGAGTTTCCGAAGCACTTCAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170693.1-1336s1c1
Sequence:CCGGCAACGAGAAGCAGGTTTATTTCTCGAGAAATAAACCTGCTTCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-1218s1c1
Sequence:CCGGGATGATGACATCTTGGATTGCCTCGAGGCAATCCAAGATGTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.1-1702s1c1
Sequence:CCGGGTTCTGACACTAAGACATTAGCTCGAGCTAATGTCTTAGTGTCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-230s1c1
Sequence:CCGGGCCCACGGACTTCGACTTCCTCTCGAGAGGAAGTCGAAGTCCGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-729s1c1
Sequence:CCGGCCTGAGTACTTGGCACCTGAACTCGAGTTCAGGTGCCAAGTACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170693.1-463s21c1
Sequence:CCGGTCTACTTCGTGCTCGACTATGCTCGAGCATAGTCGAGCACGAAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-650s21c1
Sequence:CCGGACACGTGGTGCTGACGGATTTCTCGAGAAATCCGTCAGCACCACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-587s21c1
Sequence:CCGGGCACTCCCTCAACATCATTTACTCGAGTAAATGATGTTGAGGGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170693
VALIDATED
SGK2 MISSION shRNA Lentiviral Transduction Particles
serum/glucocorticoid regulated kinase 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.x-1181s1c1
Sequence:CCGGCTCAAGTGCATTCCTGGGATTCTCGAGAATCCCAGGAATGCACTTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-1648s1c1
Sequence:CCGGGCTGGGAGATGTGGCTTATTTCTCGAGAAATAAGCCACATCTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-587s1c1
Sequence:CCGGGCACTCCCTCAACATCATTTACTCGAGTAAATGATGTTGAGGGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-1053s1c1
Sequence:CCGGACTCCACCCTTCAACCCAAATCTCGAGATTTGGGTTGAAGGGTGGAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.x-698s1c1
Sequence:CCGGTGAAGACACCACATCCACATTCTCGAGAATGTGGATGTGGTGTCTTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-1336s21c1
Sequence:CCGGCAACGAGAAGCAGGTTTATTTCTCGAGAAATAAACCTGCTTCTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-698s21c1
Sequence:CCGGTGAAGACACCACATCCACATTCTCGAGAATGTGGATGTGGTGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-741s1c1
Sequence:CCGGGCACCTGAAGTGCTTCGGAAACTCGAGTTTCCGAAGCACTTCAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170693.1-1336s1c1
Sequence:CCGGCAACGAGAAGCAGGTTTATTTCTCGAGAAATAAACCTGCTTCTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-1218s1c1
Sequence:CCGGGATGATGACATCTTGGATTGCCTCGAGGCAATCCAAGATGTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_170693.1-1702s1c1
Sequence:CCGGGTTCTGACACTAAGACATTAGCTCGAGCTAATGTCTTAGTGTCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-230s1c1
Sequence:CCGGGCCCACGGACTTCGACTTCCTCTCGAGAGGAAGTCGAAGTCCGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170693.1-729s1c1
Sequence:CCGGCCTGAGTACTTGGCACCTGAACTCGAGTTCAGGTGCCAAGTACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170693.1-463s21c1
Sequence:CCGGTCTACTTCGTGCTCGACTATGCTCGAGCATAGTCGAGCACGAAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-650s21c1
Sequence:CCGGACACGTGGTGCTGACGGATTTCTCGAGAAATCCGTCAGCACCACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_170693.1-587s21c1
Sequence:CCGGGCACTCCCTCAACATCATTTACTCGAGTAAATGATGTTGAGGGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)