EMAIL THIS PAGE TO A FRIEND

SGK3

serum/glucocorticoid regulated kinase family, member 3

172 Gene Product Result for
Synonyms: CISK SGK2 SGKL
UniProtKB ID: Q96BR1, A8K5W3, B3KQC2, Q9P1Q7, Q9UKG5
Gene ID:
Human(23678) Summary: This gene is a member of the Ser/Thr protein kinase family and encodes a phosphoprotein with a PX (phox homology) domain. The protein phosphorylates several target proteins and has a role in neutral amino acid transport and activation of potassium and chloride channels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(170755) serum/glucocorticoid regulated kinase 3
Rat(171498) serum/glucocorticoid regulated kinase family, member 3
Zebrafish(564523) serum/glucocorticoid regulated kinase family, member 3
chicken(420167) serum/glucocorticoid regulated kinase family, member 3
dog(486981) serum/glucocorticoid regulated kinase family, member 3
domestic cat(101095636) serum/glucocorticoid regulated kinase family, member 3
Horse(100052030) serum/glucocorticoid regulated kinase family, member 3
cow(504480) serum/glucocorticoid regulated kinase family, member 3
sheep(101122444) serum/glucocorticoid regulated kinase family, member 3
naked mole-rat(101712816) serum/glucocorticoid regulated kinase family, member 3
Domestic Rabbit(100343709) serum/glucocorticoid regulated kinase family, member 3
domestic guinea pig(100714729) serum/glucocorticoid regulated kinase family, member 3
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
12-555 Crosstide KK Crosstide KK primarily used in Kinase Assays. human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033578 Rosetta Predictions human pricing
NM_013257 Rosetta Predictions human pricing
NM_170709 Rosetta Predictions human pricing
XM_001060531 Rosetta Predictions rat pricing
NM_001037759 Rosetta Predictions mouse pricing
NM_133220 Rosetta Predictions mouse pricing
NM_177547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219412 predicted 766
2 SASI_Hs01_00219413 predicted 1836
3 SASI_Hs01_00219414 predicted 1653
4 SASI_Hs01_00219415 predicted 1822
5 SASI_Hs01_00219416 predicted 440
6 SASI_Hs01_00219417 predicted 1682
7 SASI_Hs02_00308066 predicted 493
8 SASI_Hs01_00219419 predicted 803
9 SASI_Hs02_00308067 predicted 557
10 SASI_Hs02_00308068 predicted 1636
11 SASI_Hs01_00219418 predicted 447
12 SASI_Hs01_00219420 predicted 460
13 SASI_Hs01_00219421 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220832 predicted 678
2 SASI_Hs01_00220833 predicted 1752
3 SASI_Hs01_00220834 predicted 1574
4 SASI_Hs01_00220835 predicted 1733
5 SASI_Hs01_00220836 predicted 355
6 SASI_Hs01_00220837 predicted 1599
7 SASI_Hs02_00344475 predicted 408
8 SASI_Hs01_00220839 predicted 725
9 SASI_Hs02_00344476 predicted 470
10 SASI_Hs02_00344477 predicted 1548
11 SASI_Hs01_00220838 predicted 364
12 SASI_Hs01_00220840 predicted 369
13 SASI_Hs01_00220841 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231590 predicted 675
2 SASI_Hs01_00231591 predicted 1652
3 SASI_Hs01_00231592 predicted 1471
4 SASI_Hs01_00231593 predicted 1635
5 SASI_Hs01_00231594 predicted 353
6 SASI_Hs01_00231595 predicted 1498
7 SASI_Hs02_00367653 predicted 410
8 SASI_Hs01_00231597 predicted 719
9 SASI_Hs02_00367654 predicted 470
10 SASI_Hs02_00367655 predicted 1454
11 SASI_Hs01_00231596 predicted 361
12 SASI_Hs01_00231598 predicted 376
13 SASI_Hs01_00231599 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296882 predicted 1320
2 SASI_Rn02_00296883 predicted 623
3 SASI_Rn02_00296884 predicted 1444
4 SASI_Rn02_00296885 predicted 1496
5 SASI_Rn02_00296886 predicted 1659
6 SASI_Rn02_00296887 predicted 949
7 SASI_Rn02_00296888 predicted 424
8 SASI_Rn02_00296889 predicted 1081
9 SASI_Rn02_00296890 predicted 543
10 SASI_Rn02_00296891 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289425 predicted 646
2 SASI_Mm02_00289426 predicted 1435
3 SASI_Mm02_00289427 predicted 489
4 SASI_Mm02_00289428 predicted 1107
5 SASI_Mm02_00289429 predicted 563
6 SASI_Mm02_00289430 predicted 1229
7 SASI_Mm02_00289431 predicted 1617
8 SASI_Mm02_00289432 predicted 1655
9 SASI_Mm02_00289433 predicted 976
10 SASI_Mm02_00289434 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338433 predicted 766
2 SASI_Mm02_00338434 predicted 1558
3 SASI_Mm02_00338435 predicted 608
4 SASI_Mm02_00338436 predicted 1226
5 SASI_Mm02_00338437 predicted 680
6 SASI_Mm02_00338438 predicted 1349
7 SASI_Mm02_00338439 predicted 1742
8 SASI_Mm02_00338440 predicted 1777
9 SASI_Mm02_00338441 predicted 1093
10 SASI_Mm02_00338442 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347699 predicted 658
2 SASI_Mm02_00347700 predicted 1448
3 SASI_Mm02_00347701 predicted 499
4 SASI_Mm02_00347702 predicted 1115
5 SASI_Mm02_00347703 predicted 575
6 SASI_Mm02_00347704 predicted 1244
7 SASI_Mm02_00347705 predicted 1629
8 SASI_Mm02_00347706 predicted 1669
9 SASI_Mm02_00347707 predicted 992
10 SASI_Mm02_00347708 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170709
VALIDATED
SGK3 MISSION shRNA Bacterial Glycerol Stock
serum/glucocorticoid regulated kinase family, member 3
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-838s21c1
Sequence:CCGGGGCTGAACGTAATGTGCTCTTCTCGAGAAGAGCACATTACGTTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-488s21c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170709.1-1415s1c1
Sequence:CCGGCCACCACCATTTAATCCTAATCTCGAGATTAGGATTAAATGGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170709.x-1037s1c1
Sequence:CCGGGGTTACTTACATTCCATCAAACTCGAGTTTGATGGAATGTAAGTAACCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-1561s1c1
Sequence:CCGGATTCGTTGGTTTCTCTTATGCCTCGAGGCATAAGAGAAACCAACGAATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-488s1c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-1386s1c1
Sequence:CCGGGCTGGGCTGACCTTGTACAAACTCGAGTTTGTACAAGGTCAGCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-2103s1c1
Sequence:CCGGGTTCATGGTATGATCGAAATGCTCGAGCATTTCGATCATACCATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-1386s21c1
Sequence:CCGGGCTGGGCTGACCTTGTACAAACTCGAGTTTGTACAAGGTCAGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-838s1c1
Sequence:CCGGGGCTGAACGTAATGTGCTCTTCTCGAGAAGAGCACATTACGTTCAGCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170709.1-2103s21c1
Sequence:CCGGGTTCATGGTATGATCGAAATGCTCGAGCATTTCGATCATACCATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-249s1c1
Sequence:CCGGGCTGCCCAAGTGTAAGCATTCCTCGAGGAATGCTTACACTTGGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-2179s1c1
Sequence:CCGGGCAGATCATTTAAGAAGTAACCTCGAGGTTACTTCTTAAATGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-3775s1c1
Sequence:CCGGCCTTTAGAGGTAAGACTTTAACTCGAGTTAAAGTCTTACCTCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-1515s1c1
Sequence:CCGGCTGACTATTCTATAGTGAATGCTCGAGCATTCACTATAGAATAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-3311s1c1
Sequence:CCGGCCAACTAACTTACATGCTTATCTCGAGATAAGCATGTAAGTTAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-435s1c1
Sequence:CCGGCCAAGAGAATATTTGGTGATACTCGAGTATCACCAAATATTCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-1101s1c1
Sequence:CCGGCAGTAGGACATGTTGTCTTAACTCGAGTTAAGACAACATGTCCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-1559s21c1
Sequence:CCGGGCATTCGTTGGTTTCTCTTATCTCGAGATAAGAGAAACCAACGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170709
VALIDATED
SGK3 MISSION shRNA shRNA Plasmid DNA
serum/glucocorticoid regulated kinase family, member 3
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-838s21c1
Sequence:CCGGGGCTGAACGTAATGTGCTCTTCTCGAGAAGAGCACATTACGTTCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-488s21c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170709.1-1415s1c1
Sequence:CCGGCCACCACCATTTAATCCTAATCTCGAGATTAGGATTAAATGGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170709.x-1037s1c1
Sequence:CCGGGGTTACTTACATTCCATCAAACTCGAGTTTGATGGAATGTAAGTAACCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-1561s1c1
Sequence:CCGGATTCGTTGGTTTCTCTTATGCCTCGAGGCATAAGAGAAACCAACGAATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-488s1c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-1386s1c1
Sequence:CCGGGCTGGGCTGACCTTGTACAAACTCGAGTTTGTACAAGGTCAGCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-2103s1c1
Sequence:CCGGGTTCATGGTATGATCGAAATGCTCGAGCATTTCGATCATACCATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-1386s21c1
Sequence:CCGGGCTGGGCTGACCTTGTACAAACTCGAGTTTGTACAAGGTCAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-838s1c1
Sequence:CCGGGGCTGAACGTAATGTGCTCTTCTCGAGAAGAGCACATTACGTTCAGCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170709.1-2103s21c1
Sequence:CCGGGTTCATGGTATGATCGAAATGCTCGAGCATTTCGATCATACCATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-249s1c1
Sequence:CCGGGCTGCCCAAGTGTAAGCATTCCTCGAGGAATGCTTACACTTGGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-2179s1c1
Sequence:CCGGGCAGATCATTTAAGAAGTAACCTCGAGGTTACTTCTTAAATGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-3775s1c1
Sequence:CCGGCCTTTAGAGGTAAGACTTTAACTCGAGTTAAAGTCTTACCTCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-1515s1c1
Sequence:CCGGCTGACTATTCTATAGTGAATGCTCGAGCATTCACTATAGAATAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-3311s1c1
Sequence:CCGGCCAACTAACTTACATGCTTATCTCGAGATAAGCATGTAAGTTAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-435s1c1
Sequence:CCGGCCAAGAGAATATTTGGTGATACTCGAGTATCACCAAATATTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-1101s1c1
Sequence:CCGGCAGTAGGACATGTTGTCTTAACTCGAGTTAAGACAACATGTCCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-1559s21c1
Sequence:CCGGGCATTCGTTGGTTTCTCTTATCTCGAGATAAGAGAAACCAACGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170709
VALIDATED
SGK3 MISSION shRNA Lentiviral Transduction Particles
serum/glucocorticoid regulated kinase family, member 3
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-838s21c1
Sequence:CCGGGGCTGAACGTAATGTGCTCTTCTCGAGAAGAGCACATTACGTTCAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-488s21c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170709.1-1415s1c1
Sequence:CCGGCCACCACCATTTAATCCTAATCTCGAGATTAGGATTAAATGGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170709.x-1037s1c1
Sequence:CCGGGGTTACTTACATTCCATCAAACTCGAGTTTGATGGAATGTAAGTAACCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-1561s1c1
Sequence:CCGGATTCGTTGGTTTCTCTTATGCCTCGAGGCATAAGAGAAACCAACGAATTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-488s1c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-1386s1c1
Sequence:CCGGGCTGGGCTGACCTTGTACAAACTCGAGTTTGTACAAGGTCAGCCCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-2103s1c1
Sequence:CCGGGTTCATGGTATGATCGAAATGCTCGAGCATTTCGATCATACCATGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-1386s21c1
Sequence:CCGGGCTGGGCTGACCTTGTACAAACTCGAGTTTGTACAAGGTCAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.x-838s1c1
Sequence:CCGGGGCTGAACGTAATGTGCTCTTCTCGAGAAGAGCACATTACGTTCAGCCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170709.1-2103s21c1
Sequence:CCGGGTTCATGGTATGATCGAAATGCTCGAGCATTTCGATCATACCATGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-249s1c1
Sequence:CCGGGCTGCCCAAGTGTAAGCATTCCTCGAGGAATGCTTACACTTGGGCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-2179s1c1
Sequence:CCGGGCAGATCATTTAAGAAGTAACCTCGAGGTTACTTCTTAAATGATCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170709.1-3775s1c1
Sequence:CCGGCCTTTAGAGGTAAGACTTTAACTCGAGTTAAAGTCTTACCTCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-1515s1c1
Sequence:CCGGCTGACTATTCTATAGTGAATGCTCGAGCATTCACTATAGAATAGTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-3311s1c1
Sequence:CCGGCCAACTAACTTACATGCTTATCTCGAGATAAGCATGTAAGTTAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-435s1c1
Sequence:CCGGCCAAGAGAATATTTGGTGATACTCGAGTATCACCAAATATTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_170709.1-1101s1c1
Sequence:CCGGCAGTAGGACATGTTGTCTTAACTCGAGTTAAGACAACATGTCCTACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170709.1-1559s21c1
Sequence:CCGGGCATTCGTTGGTTTCTCTTATCTCGAGATAAGAGAAACCAACGAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013257
VALIDATED
SGK3 MISSION shRNA Bacterial Glycerol Stock
serum/glucocorticoid regulated kinase family, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-1302s1c1
Sequence:CCGGGCCGAGATGTTGCTGAAATGTCTCGAGACATTTCAGCAACATCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013257.x-1655s1c1
Sequence:CCGGGCATTCGTTGGTTTCTCTTATCTCGAGATAAGAGAAACCAACGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-842s1c1
Sequence:CCGGGAACGTAATGTGCTCTTGAAACTCGAGTTTCAAGAGCACATTACGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-488s1c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013257.x-3234s1c1
Sequence:CCGGGCGAGACCCTAGTTAAGAGAACTCGAGTTCTCTTAACTAGGGTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013257
VALIDATED
SGK3 MISSION shRNA shRNA Plasmid DNA
serum/glucocorticoid regulated kinase family, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-1302s1c1
Sequence:CCGGGCCGAGATGTTGCTGAAATGTCTCGAGACATTTCAGCAACATCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013257.x-1655s1c1
Sequence:CCGGGCATTCGTTGGTTTCTCTTATCTCGAGATAAGAGAAACCAACGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-842s1c1
Sequence:CCGGGAACGTAATGTGCTCTTGAAACTCGAGTTTCAAGAGCACATTACGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-488s1c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013257.x-3234s1c1
Sequence:CCGGGCGAGACCCTAGTTAAGAGAACTCGAGTTCTCTTAACTAGGGTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013257
VALIDATED
SGK3 MISSION shRNA Lentiviral Transduction Particles
serum/glucocorticoid regulated kinase family, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-1302s1c1
Sequence:CCGGGCCGAGATGTTGCTGAAATGTCTCGAGACATTTCAGCAACATCTCGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013257.x-1655s1c1
Sequence:CCGGGCATTCGTTGGTTTCTCTTATCTCGAGATAAGAGAAACCAACGAATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-842s1c1
Sequence:CCGGGAACGTAATGTGCTCTTGAAACTCGAGTTTCAAGAGCACATTACGTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013257.x-488s1c1
Sequence:CCGGGCAGGACTAAACGAATTCATTCTCGAGAATGAATTCGTTTAGTCCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013257.x-3234s1c1
Sequence:CCGGGCGAGACCCTAGTTAAGAGAACTCGAGTTCTCTTAACTAGGGTCTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133220
VALIDATED
SGK3 MISSION shRNA Bacterial Glycerol Stock
serum/glucocorticoid regulated kinase family, member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-1504s1c1
Sequence:CCGGGCCAAAGAAGACTTTCTTGAACTCGAGTTCAAGAAAGTCTTCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-853s1c1
Sequence:CCGGGCTGTCAAAGTGTTACAGAAACTCGAGTTTCTGTAACACTTTGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-508s1c1
Sequence:CCGGGCCAAGAGAATATTTGGTGATCTCGAGATCACCAAATATTCTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-1211s1c1
Sequence:CCGGGCAAAGAAGGAATCGCTATTTCTCGAGAAATAGCGATTCCTTCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-441s1c1
Sequence:CCGGCGCAGAGTTTGACAAACTTTACTCGAGTAAAGTTTGTCAAACTCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-911s21c1
Sequence:CCGGGCTGTCAAAGTGTTACAGAAACTCGAGTTTCTGTAACACTTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-499s21c1
Sequence:CCGGCGCAGAGTTTGACAAACTTTACTCGAGTAAAGTTTGTCAAACTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-1269s21c1
Sequence:CCGGGCAAAGAAGGAATCGCTATTTCTCGAGAAATAGCGATTCCTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-1562s21c1
Sequence:CCGGGCCAAAGAAGACTTTCTTGAACTCGAGTTCAAGAAAGTCTTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133220
VALIDATED
SGK3 MISSION shRNA shRNA Plasmid DNA
serum/glucocorticoid regulated kinase family, member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-1504s1c1
Sequence:CCGGGCCAAAGAAGACTTTCTTGAACTCGAGTTCAAGAAAGTCTTCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-853s1c1
Sequence:CCGGGCTGTCAAAGTGTTACAGAAACTCGAGTTTCTGTAACACTTTGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-508s1c1
Sequence:CCGGGCCAAGAGAATATTTGGTGATCTCGAGATCACCAAATATTCTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-1211s1c1
Sequence:CCGGGCAAAGAAGGAATCGCTATTTCTCGAGAAATAGCGATTCCTTCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-441s1c1
Sequence:CCGGCGCAGAGTTTGACAAACTTTACTCGAGTAAAGTTTGTCAAACTCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-911s21c1
Sequence:CCGGGCTGTCAAAGTGTTACAGAAACTCGAGTTTCTGTAACACTTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-499s21c1
Sequence:CCGGCGCAGAGTTTGACAAACTTTACTCGAGTAAAGTTTGTCAAACTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-1269s21c1
Sequence:CCGGGCAAAGAAGGAATCGCTATTTCTCGAGAAATAGCGATTCCTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-1562s21c1
Sequence:CCGGGCCAAAGAAGACTTTCTTGAACTCGAGTTCAAGAAAGTCTTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133220
VALIDATED
SGK3 MISSION shRNA Lentiviral Transduction Particles
serum/glucocorticoid regulated kinase family, member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-1504s1c1
Sequence:CCGGGCCAAAGAAGACTTTCTTGAACTCGAGTTCAAGAAAGTCTTCTTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-853s1c1
Sequence:CCGGGCTGTCAAAGTGTTACAGAAACTCGAGTTTCTGTAACACTTTGACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-508s1c1
Sequence:CCGGGCCAAGAGAATATTTGGTGATCTCGAGATCACCAAATATTCTCTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-1211s1c1
Sequence:CCGGGCAAAGAAGGAATCGCTATTTCTCGAGAAATAGCGATTCCTTCTTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133220.1-441s1c1
Sequence:CCGGCGCAGAGTTTGACAAACTTTACTCGAGTAAAGTTTGTCAAACTCTGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-911s21c1
Sequence:CCGGGCTGTCAAAGTGTTACAGAAACTCGAGTTTCTGTAACACTTTGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-499s21c1
Sequence:CCGGCGCAGAGTTTGACAAACTTTACTCGAGTAAAGTTTGTCAAACTCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-1269s21c1
Sequence:CCGGGCAAAGAAGGAATCGCTATTTCTCGAGAAATAGCGATTCCTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133220.2-1562s21c1
Sequence:CCGGGCCAAAGAAGACTTTCTTGAACTCGAGTTCAAGAAAGTCTTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)