EMAIL THIS PAGE TO A FRIEND

SGMS1

sphingomyelin synthase 1

134 Gene Product Result for
Synonyms: MOB MOB1 SMS1 TMEM23 hmob33
UniProtKB ID: Q86VZ5, Q68U43, Q6EKK0, Q75SP1
Gene ID:
Human(259230) Summary: The protein encoded by this gene is predicted to be a five-pass transmembrane protein. This gene may be predominately expressed in brain. [provided by RefSeq, Jul 2008]
Mouse(208449) sphingomyelin synthase 1
Rat(353229) sphingomyelin synthase 1
cow(533538) sphingomyelin synthase 1
sheep(101118575) sphingomyelin synthase 1
domestic guinea pig(100730655) sphingomyelin synthase 1
naked mole-rat(101710267) sphingomyelin synthase 1
Zebrafish(566563) sphingomyelin synthase 1
Horse(100062484) sphingomyelin synthase 1
domestic cat(101090897) sphingomyelin synthase 1
dog(477582) sphingomyelin synthase 1
chicken(378907) sphingomyelin synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045191 Anti-SGMS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102133 Anti-SGMS1 antibody produced in rabbit affinity isolated antibody mouse, horse, human, rat, rabbit, dog, guinea pig, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147156 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147156 Rosetta Predictions human pricing
NM_181386 Rosetta Predictions rat pricing
NM_144792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060990 predicted 1527
2 SASI_Hs01_00060991 predicted 2189
3 SASI_Hs01_00060992 predicted 1269
4 SASI_Hs01_00060993 predicted 961
5 SASI_Hs01_00060994 predicted 2094
6 SASI_Hs01_00060995 predicted 1671
7 SASI_Hs01_00060996 predicted 1891
8 SASI_Hs01_00060997 predicted 1757
9 SASI_Hs01_00060998 predicted 1718
10 SASI_Hs02_00365488 predicted 2279
11 SASI_Hs01_00060999 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080761 predicted 1015
2 SASI_Rn01_00080762 predicted 1477
3 SASI_Rn01_00080763 predicted 1523
4 SASI_Rn01_00080764 predicted 1386
5 SASI_Rn01_00080765 predicted 1954
6 SASI_Rn01_00080766 predicted 1845
7 SASI_Rn01_00080767 predicted 1125
8 SASI_Rn01_00080768 predicted 806
9 SASI_Rn01_00080769 predicted 987
10 SASI_Rn01_00080770 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156937 predicted 548
2 SASI_Mm01_00156938 predicted 494
3 SASI_Mm01_00156939 predicted 1479
4 SASI_Mm01_00156940 predicted 339
5 SASI_Mm01_00156941 predicted 1006
6 SASI_Mm01_00156942 predicted 1155
7 SASI_Mm01_00156943 predicted 509
8 SASI_Mm01_00156944 predicted 1098
9 SASI_Mm01_00156945 predicted 1219
10 SASI_Mm01_00156946 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147156
SGMS1 MISSION shRNA Bacterial Glycerol Stock
sphingomyelin synthase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1272s1c1
Sequence:CCGGGATGCCAAATGGGTATAGGAACTCGAGTTCCTATACCCATTTGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1716s1c1
Sequence:CCGGCCAACTGCGAAGAATAATGAACTCGAGTTCATTATTCTTCGCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147156.3-2370s1c1
Sequence:CCGGGCGTTGGACAACAATAAAGAACTCGAGTTCTTTATTGTTGTCCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147156.3-1948s21c1
Sequence:CCGGGACGTGGTGGTGGCATATTACCTCGAGGTAATATGCCACCACCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1722s1c1
Sequence:CCGGGCGAAGAATAATGAAGCTCATCTCGAGATGAGCTTCATTATTCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-2151s1c1
Sequence:CCGGCCTCAGTAGGCAAGTTAAATACTCGAGTATTTAACTTGCCTACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147156.3-1618s21c1
Sequence:CCGGCTGTACCTGTATCGGTGTATTCTCGAGAATACACCGATACAGGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147156.3-2474s21c1
Sequence:CCGGATATGATGCAGCAGCATAAATCTCGAGATTTATGCTGCTGCATCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147156
SGMS1 MISSION shRNA shRNA Plasmid DNA
sphingomyelin synthase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1272s1c1
Sequence:CCGGGATGCCAAATGGGTATAGGAACTCGAGTTCCTATACCCATTTGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1716s1c1
Sequence:CCGGCCAACTGCGAAGAATAATGAACTCGAGTTCATTATTCTTCGCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147156.3-2370s1c1
Sequence:CCGGGCGTTGGACAACAATAAAGAACTCGAGTTCTTTATTGTTGTCCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147156.3-1948s21c1
Sequence:CCGGGACGTGGTGGTGGCATATTACCTCGAGGTAATATGCCACCACCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1722s1c1
Sequence:CCGGGCGAAGAATAATGAAGCTCATCTCGAGATGAGCTTCATTATTCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-2151s1c1
Sequence:CCGGCCTCAGTAGGCAAGTTAAATACTCGAGTATTTAACTTGCCTACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147156.3-1618s21c1
Sequence:CCGGCTGTACCTGTATCGGTGTATTCTCGAGAATACACCGATACAGGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147156.3-2474s21c1
Sequence:CCGGATATGATGCAGCAGCATAAATCTCGAGATTTATGCTGCTGCATCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147156
SGMS1 MISSION shRNA Lentiviral Transduction Particles
sphingomyelin synthase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1272s1c1
Sequence:CCGGGATGCCAAATGGGTATAGGAACTCGAGTTCCTATACCCATTTGGCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1716s1c1
Sequence:CCGGCCAACTGCGAAGAATAATGAACTCGAGTTCATTATTCTTCGCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147156.3-2370s1c1
Sequence:CCGGGCGTTGGACAACAATAAAGAACTCGAGTTCTTTATTGTTGTCCAACGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147156.3-1948s21c1
Sequence:CCGGGACGTGGTGGTGGCATATTACCTCGAGGTAATATGCCACCACCACGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-1722s1c1
Sequence:CCGGGCGAAGAATAATGAAGCTCATCTCGAGATGAGCTTCATTATTCTTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147156.3-2151s1c1
Sequence:CCGGCCTCAGTAGGCAAGTTAAATACTCGAGTATTTAACTTGCCTACTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147156.3-1618s21c1
Sequence:CCGGCTGTACCTGTATCGGTGTATTCTCGAGAATACACCGATACAGGTACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147156.3-2474s21c1
Sequence:CCGGATATGATGCAGCAGCATAAATCTCGAGATTTATGCTGCTGCATCATATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144792
VALIDATED
SGMS1 MISSION shRNA Bacterial Glycerol Stock
sphingomyelin synthase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1017s1c1
Sequence:CCGGCGGTGTATTACAATGTATGTACTCGAGTACATACATTGTAATACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1535s1c1
Sequence:CCGGCCACCTTAGTAGGCAAGTTAACTCGAGTTAACTTGCCTACTAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144792.3-439s1c1
Sequence:CCGGGCCAGGACTTAATCAACCTAACTCGAGTTAGGTTGATTAAGTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-2548s1c1
Sequence:CCGGGCTGAGATTATGCCATCTGTTCTCGAGAACAGATGGCATAATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1005s21c1
Sequence:CCGGCTGTACCTGTATCGGTGTATTCTCGAGAATACACCGATACAGGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1110s1c1
Sequence:CCGGCGGAGAATAATGAAGCTCATTCTCGAGAATGAGCTTCATTATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1536s21c1
Sequence:CCGGCACCTTAGTAGGCAAGTTAAACTCGAGTTTAACTTGCCTACTAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-922s21c1
Sequence:CCGGTTGTAGGACTCTGGCTATTTCCTCGAGGAAATAGCCAGAGTCCTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1207s21c1
Sequence:CCGGTAACGCTCACCTACCTATTTACTCGAGTAAATAGGTAGGTGAGCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144792.3-1683s21c1
Sequence:CCGGTTACCTTGACTTAACCTATTGCTCGAGCAATAGGTTAAGTCAAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144792
VALIDATED
SGMS1 MISSION shRNA shRNA Plasmid DNA
sphingomyelin synthase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1017s1c1
Sequence:CCGGCGGTGTATTACAATGTATGTACTCGAGTACATACATTGTAATACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1535s1c1
Sequence:CCGGCCACCTTAGTAGGCAAGTTAACTCGAGTTAACTTGCCTACTAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144792.3-439s1c1
Sequence:CCGGGCCAGGACTTAATCAACCTAACTCGAGTTAGGTTGATTAAGTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-2548s1c1
Sequence:CCGGGCTGAGATTATGCCATCTGTTCTCGAGAACAGATGGCATAATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1005s21c1
Sequence:CCGGCTGTACCTGTATCGGTGTATTCTCGAGAATACACCGATACAGGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1110s1c1
Sequence:CCGGCGGAGAATAATGAAGCTCATTCTCGAGAATGAGCTTCATTATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1536s21c1
Sequence:CCGGCACCTTAGTAGGCAAGTTAAACTCGAGTTTAACTTGCCTACTAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-922s21c1
Sequence:CCGGTTGTAGGACTCTGGCTATTTCCTCGAGGAAATAGCCAGAGTCCTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1207s21c1
Sequence:CCGGTAACGCTCACCTACCTATTTACTCGAGTAAATAGGTAGGTGAGCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144792.3-1683s21c1
Sequence:CCGGTTACCTTGACTTAACCTATTGCTCGAGCAATAGGTTAAGTCAAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144792
VALIDATED
SGMS1 MISSION shRNA Lentiviral Transduction Particles
sphingomyelin synthase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1017s1c1
Sequence:CCGGCGGTGTATTACAATGTATGTACTCGAGTACATACATTGTAATACACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1535s1c1
Sequence:CCGGCCACCTTAGTAGGCAAGTTAACTCGAGTTAACTTGCCTACTAAGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144792.3-439s1c1
Sequence:CCGGGCCAGGACTTAATCAACCTAACTCGAGTTAGGTTGATTAAGTCCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-2548s1c1
Sequence:CCGGGCTGAGATTATGCCATCTGTTCTCGAGAACAGATGGCATAATCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1005s21c1
Sequence:CCGGCTGTACCTGTATCGGTGTATTCTCGAGAATACACCGATACAGGTACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144792.3-1110s1c1
Sequence:CCGGCGGAGAATAATGAAGCTCATTCTCGAGAATGAGCTTCATTATTCTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1536s21c1
Sequence:CCGGCACCTTAGTAGGCAAGTTAAACTCGAGTTTAACTTGCCTACTAAGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-922s21c1
Sequence:CCGGTTGTAGGACTCTGGCTATTTCCTCGAGGAAATAGCCAGAGTCCTACAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144792.3-1207s21c1
Sequence:CCGGTAACGCTCACCTACCTATTTACTCGAGTAAATAGGTAGGTGAGCGTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144792.3-1683s21c1
Sequence:CCGGTTACCTTGACTTAACCTATTGCTCGAGCAATAGGTTAAGTCAAGGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)