EMAIL THIS PAGE TO A FRIEND

SGOL1

shugoshin-like 1 (S. pombe)

128 Gene Product Result for
Synonyms: NY-BR-85 SGO Sgo1
Gene ID:
Mouse(72415) shugoshin-like 1 (S. pombe)
Rat(363174) shugoshin-like 1 (S. pombe)
chicken(420650) shugoshin-like 1 (S. pombe)
dog(610343) shugoshin-like 1 (S. pombe)
domestic cat(101100662) shugoshin-like 1 (S. pombe)
Horse(100051935) shugoshin-like 1 (S. pombe)
cow(614056) shugoshin-like 1 (S. pombe)
sheep(101116014) shugoshin-like 1 (S. pombe)
domestic guinea pig(100718738) shugoshin-like 1 (S. pombe)
naked mole-rat(101698945) shugoshin-like 1 (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0018 AQUA Peptide LIQPGTFT[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012410 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022391 MISSION® esiRNA esiRNA targeting mouse Sgol1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012409 Rosetta Predictions human pricing
NM_001012410 Rosetta Predictions human pricing
NM_001012411 Rosetta Predictions human pricing
NM_001012412 Rosetta Predictions human pricing
NM_001012413 Rosetta Predictions human pricing
NM_138484 Rosetta Predictions human pricing
XM_001065750 Rosetta Predictions rat pricing
XM_343514 Rosetta Predictions rat pricing
NM_028232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193933 predicted 254
2 SASI_Hs02_00306090 predicted 371
3 SASI_Hs02_00306091 predicted 355
4 SASI_Hs02_00306092 predicted 285
5 SASI_Hs02_00306093 predicted 269
6 SASI_Hs01_00193935 predicted 224
7 SASI_Hs01_00193937 predicted 261
8 SASI_Hs01_00193939 predicted 253
9 SASI_Hs01_00193940 predicted 259
10 SASI_Hs01_00193941 predicted 231
11 SASI_Hs01_00193934 predicted 377
12 SASI_Hs01_00193936 predicted 281
13 SASI_Hs01_00193938 predicted 285
14 SASI_Hs01_00193942 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168960 predicted 256
2 SASI_Hs02_00306094 predicted 368
3 SASI_Hs02_00306095 predicted 358
4 SASI_Hs02_00306096 predicted 279
5 SASI_Hs02_00306097 predicted 264
6 SASI_Hs01_00168962 predicted 222
7 SASI_Hs01_00168964 predicted 254
8 SASI_Hs01_00168966 predicted 252
9 SASI_Hs01_00168967 predicted 257
10 SASI_Hs01_00168968 predicted 234
11 SASI_Hs01_00168961 predicted 369
12 SASI_Hs01_00168963 predicted 283
13 SASI_Hs01_00168965 predicted 283
14 SASI_Hs01_00168969 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228034 predicted 259
2 SASI_Hs02_00306098 predicted 371
3 SASI_Hs02_00306099 predicted 362
4 SASI_Hs02_00306100 predicted 279
5 SASI_Hs02_00306101 predicted 271
6 SASI_Hs01_00228036 predicted 227
7 SASI_Hs01_00228038 predicted 257
8 SASI_Hs01_00228040 predicted 256
9 SASI_Hs01_00228041 predicted 252
10 SASI_Hs01_00228042 predicted 236
11 SASI_Hs01_00228035 predicted 374
12 SASI_Hs01_00228037 predicted 281
13 SASI_Hs01_00228039 predicted 288
14 SASI_Hs01_00228043 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078342 predicted 258
2 SASI_Hs02_00306102 predicted 375
3 SASI_Hs02_00306103 predicted 358
4 SASI_Hs02_00306104 predicted 284
5 SASI_Hs02_00306105 predicted 268
6 SASI_Hs01_00078344 predicted 230
7 SASI_Hs01_00078346 predicted 254
8 SASI_Hs01_00078348 predicted 254
9 SASI_Hs01_00078349 predicted 258
10 SASI_Hs01_00078350 predicted 235
11 SASI_Hs01_00078343 predicted 377
12 SASI_Hs01_00078345 predicted 285
13 SASI_Hs01_00078347 predicted 286
14 SASI_Hs01_00078351 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208263 predicted 256
2 SASI_Hs02_00306106 predicted 376
3 SASI_Hs02_00306107 predicted 358
4 SASI_Hs02_00306108 predicted 283
5 SASI_Hs02_00306109 predicted 270
6 SASI_Hs01_00208265 predicted 223
7 SASI_Hs01_00208267 predicted 257
8 SASI_Hs01_00208269 predicted 261
9 SASI_Hs01_00208270 predicted 252
10 SASI_Hs01_00208271 predicted 233
11 SASI_Hs01_00208264 predicted 375
12 SASI_Hs01_00208266 predicted 283
13 SASI_Hs01_00208268 predicted 289
14 SASI_Hs01_00208272 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094901 predicted 259
2 SASI_Hs02_00363670 predicted 373
3 SASI_Hs02_00363671 predicted 360
4 SASI_Hs02_00363672 predicted 286
5 SASI_Hs02_00363673 predicted 270
6 SASI_Hs01_00094903 predicted 225
7 SASI_Hs01_00094905 predicted 261
8 SASI_Hs01_00094907 predicted 260
9 SASI_Hs01_00094908 predicted 258
10 SASI_Hs01_00094909 predicted 228
11 SASI_Hs01_00094902 predicted 375
12 SASI_Hs01_00094904 predicted 285
13 SASI_Hs01_00094906 predicted 280
14 SASI_Hs01_00094910 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315246 predicted 692
2 SASI_Rn02_00315247 predicted 657
3 SASI_Rn02_00315248 predicted 1133
4 SASI_Rn02_00315249 predicted 1300
5 SASI_Rn02_00315250 predicted 1559
6 SASI_Rn02_00315251 predicted 791
7 SASI_Rn02_00315252 predicted 1467
8 SASI_Rn02_00315253 predicted 1076
9 SASI_Rn02_00315254 predicted 337
10 SASI_Rn02_00315255 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395974 predicted 653
2 SASI_Rn02_00395975 predicted 1997
3 SASI_Rn02_00395976 predicted 420
4 SASI_Rn02_00395977 predicted 342
5 SASI_Rn02_00395978 predicted 1945
6 SASI_Rn02_00395979 predicted 609
7 SASI_Rn02_00395980 predicted 2004
8 SASI_Rn02_00395981 predicted 408
9 SASI_Rn02_00395982 predicted 549
10 SASI_Rn02_00395983 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171529 predicted 647
2 SASI_Mm02_00333563 predicted 469
3 SASI_Mm01_00171530 predicted 411
4 SASI_Mm01_00171531 predicted 501
5 SASI_Mm01_00171532 predicted 837
6 SASI_Mm01_00171533 predicted 967
7 SASI_Mm01_00171534 predicted 624
8 SASI_Mm02_00333564 predicted 525
9 SASI_Mm01_00171536 predicted 749
10 SASI_Mm01_00171537 predicted 1521
11 SASI_Mm01_00171535 predicted 262
12 SASI_Mm01_00171538 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028232
VALIDATED
SGOL1 MISSION shRNA Bacterial Glycerol Stock
shugoshin-like 1 (S. pombe)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-1525s1c1
Sequence:CCGGGCCTAAAGGATGTCACCAATACTCGAGTATTGGTGACATCCTTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028232.2-2118s21c1
Sequence:CCGGGTGTATCGAATGGTGATTAAGCTCGAGCTTAATCACCATTCGATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028232.1-2082s1c1
Sequence:CCGGCCCTTCTGTCATTGATTCTTTCTCGAGAAAGAATCAATGACAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-550s1c1
Sequence:CCGGCCCGACAAAGTGAAGAAACTACTCGAGTAGTTTCTTCACTTTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028232.1-835s1c1
Sequence:CCGGCCACGACTTTGGAGGATTGTACTCGAGTACAATCCTCCAAAGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-1270s1c1
Sequence:CCGGGCTGCAACAAAGAAACGGATACTCGAGTATCCGTTTCTTTGTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028232.2-978s21c1
Sequence:CCGGTTATGTTCTAGACTGATTAACCTCGAGGTTAATCAGTCTAGAACATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028232.2-792s21c1
Sequence:CCGGATATCTATCCGTCGCCATTTACTCGAGTAAATGGCGACGGATAGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028232.2-2025s21c1
Sequence:CCGGTACATAGGATGTAGATCTTTCCTCGAGGAAAGATCTACATCCTATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028232
VALIDATED
SGOL1 MISSION shRNA shRNA Plasmid DNA
shugoshin-like 1 (S. pombe)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-1525s1c1
Sequence:CCGGGCCTAAAGGATGTCACCAATACTCGAGTATTGGTGACATCCTTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028232.2-2118s21c1
Sequence:CCGGGTGTATCGAATGGTGATTAAGCTCGAGCTTAATCACCATTCGATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028232.1-2082s1c1
Sequence:CCGGCCCTTCTGTCATTGATTCTTTCTCGAGAAAGAATCAATGACAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-550s1c1
Sequence:CCGGCCCGACAAAGTGAAGAAACTACTCGAGTAGTTTCTTCACTTTGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028232.1-835s1c1
Sequence:CCGGCCACGACTTTGGAGGATTGTACTCGAGTACAATCCTCCAAAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-1270s1c1
Sequence:CCGGGCTGCAACAAAGAAACGGATACTCGAGTATCCGTTTCTTTGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028232.2-978s21c1
Sequence:CCGGTTATGTTCTAGACTGATTAACCTCGAGGTTAATCAGTCTAGAACATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028232.2-792s21c1
Sequence:CCGGATATCTATCCGTCGCCATTTACTCGAGTAAATGGCGACGGATAGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028232.2-2025s21c1
Sequence:CCGGTACATAGGATGTAGATCTTTCCTCGAGGAAAGATCTACATCCTATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028232
VALIDATED
SGOL1 MISSION shRNA Lentiviral Transduction Particles
shugoshin-like 1 (S. pombe)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-1525s1c1
Sequence:CCGGGCCTAAAGGATGTCACCAATACTCGAGTATTGGTGACATCCTTTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028232.2-2118s21c1
Sequence:CCGGGTGTATCGAATGGTGATTAAGCTCGAGCTTAATCACCATTCGATACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028232.1-2082s1c1
Sequence:CCGGCCCTTCTGTCATTGATTCTTTCTCGAGAAAGAATCAATGACAGAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-550s1c1
Sequence:CCGGCCCGACAAAGTGAAGAAACTACTCGAGTAGTTTCTTCACTTTGTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028232.1-835s1c1
Sequence:CCGGCCACGACTTTGGAGGATTGTACTCGAGTACAATCCTCCAAAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028232.1-1270s1c1
Sequence:CCGGGCTGCAACAAAGAAACGGATACTCGAGTATCCGTTTCTTTGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028232.2-978s21c1
Sequence:CCGGTTATGTTCTAGACTGATTAACCTCGAGGTTAATCAGTCTAGAACATAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028232.2-792s21c1
Sequence:CCGGATATCTATCCGTCGCCATTTACTCGAGTAAATGGCGACGGATAGATATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028232.2-2025s21c1
Sequence:CCGGTACATAGGATGTAGATCTTTCCTCGAGGAAAGATCTACATCCTATGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012410
VALIDATED
SGOL1 MISSION shRNA Bacterial Glycerol Stock
shugoshin-like 1 (S. pombe)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012410.2-1988s21c1
Sequence:CCGGTAATTAGAGATAGCAACTTTCCTCGAGGAAAGTTGCTATCTCTAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-697s1c1
Sequence:CCGGCTAGAACTGTATCTGTTCGTACTCGAGTACGAACAGATACAGTTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012410.1-1833s1c1
Sequence:CCGGCGGGCTTCACATCCTTAGAAACTCGAGTTTCTAAGGATGTGAAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-831s1c1
Sequence:CCGGCCACTAGTAAACATGCACATACTCGAGTATGTGCATGTTTACTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-1449s1c1
Sequence:CCGGCCTCATCTTAGCCTGAAGGATCTCGAGATCCTTCAGGCTAAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012410.1-555s1c1
Sequence:CCGGCCGCAAATTCCTCTTGAAGAACTCGAGTTCTTCAAGAGGAATTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012410.2-2189s21c1
Sequence:CCGGGATATTGTGTAAGCGAAATTCCTCGAGGAATTTCGCTTACACAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-612s21c1
Sequence:CCGGGAAGATCAGATACCTACTATTCTCGAGAATAGTAGGTATCTGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-1338s21c1
Sequence:CCGGGTCACCAGGCCTCTAGCTAAACTCGAGTTTAGCTAGAGGCCTGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-258s21c1
Sequence:CCGGATAGCTGCACCATGCCAAATACTCGAGTATTTGGCATGGTGCAGCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-1268s21c1
Sequence:CCGGTGATTCCGATGACCTCTATTTCTCGAGAAATAGAGGTCATCGGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-916s21c1
Sequence:CCGGTGATTCAGCCAGGAACGTTTACTCGAGTAAACGTTCCTGGCTGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012410
VALIDATED
SGOL1 MISSION shRNA shRNA Plasmid DNA
shugoshin-like 1 (S. pombe)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012410.2-1988s21c1
Sequence:CCGGTAATTAGAGATAGCAACTTTCCTCGAGGAAAGTTGCTATCTCTAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-697s1c1
Sequence:CCGGCTAGAACTGTATCTGTTCGTACTCGAGTACGAACAGATACAGTTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012410.1-1833s1c1
Sequence:CCGGCGGGCTTCACATCCTTAGAAACTCGAGTTTCTAAGGATGTGAAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-831s1c1
Sequence:CCGGCCACTAGTAAACATGCACATACTCGAGTATGTGCATGTTTACTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-1449s1c1
Sequence:CCGGCCTCATCTTAGCCTGAAGGATCTCGAGATCCTTCAGGCTAAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012410.1-555s1c1
Sequence:CCGGCCGCAAATTCCTCTTGAAGAACTCGAGTTCTTCAAGAGGAATTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012410.2-2189s21c1
Sequence:CCGGGATATTGTGTAAGCGAAATTCCTCGAGGAATTTCGCTTACACAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-612s21c1
Sequence:CCGGGAAGATCAGATACCTACTATTCTCGAGAATAGTAGGTATCTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-1338s21c1
Sequence:CCGGGTCACCAGGCCTCTAGCTAAACTCGAGTTTAGCTAGAGGCCTGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-258s21c1
Sequence:CCGGATAGCTGCACCATGCCAAATACTCGAGTATTTGGCATGGTGCAGCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-1268s21c1
Sequence:CCGGTGATTCCGATGACCTCTATTTCTCGAGAAATAGAGGTCATCGGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-916s21c1
Sequence:CCGGTGATTCAGCCAGGAACGTTTACTCGAGTAAACGTTCCTGGCTGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012410
VALIDATED
SGOL1 MISSION shRNA Lentiviral Transduction Particles
shugoshin-like 1 (S. pombe)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012410.2-1988s21c1
Sequence:CCGGTAATTAGAGATAGCAACTTTCCTCGAGGAAAGTTGCTATCTCTAATTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-697s1c1
Sequence:CCGGCTAGAACTGTATCTGTTCGTACTCGAGTACGAACAGATACAGTTCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012410.1-1833s1c1
Sequence:CCGGCGGGCTTCACATCCTTAGAAACTCGAGTTTCTAAGGATGTGAAGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-831s1c1
Sequence:CCGGCCACTAGTAAACATGCACATACTCGAGTATGTGCATGTTTACTAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012410.1-1449s1c1
Sequence:CCGGCCTCATCTTAGCCTGAAGGATCTCGAGATCCTTCAGGCTAAGATGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012410.1-555s1c1
Sequence:CCGGCCGCAAATTCCTCTTGAAGAACTCGAGTTCTTCAAGAGGAATTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012410.2-2189s21c1
Sequence:CCGGGATATTGTGTAAGCGAAATTCCTCGAGGAATTTCGCTTACACAATATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-612s21c1
Sequence:CCGGGAAGATCAGATACCTACTATTCTCGAGAATAGTAGGTATCTGATCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-1338s21c1
Sequence:CCGGGTCACCAGGCCTCTAGCTAAACTCGAGTTTAGCTAGAGGCCTGGTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-258s21c1
Sequence:CCGGATAGCTGCACCATGCCAAATACTCGAGTATTTGGCATGGTGCAGCTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-1268s21c1
Sequence:CCGGTGATTCCGATGACCTCTATTTCTCGAGAAATAGAGGTCATCGGAATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012410.2-916s21c1
Sequence:CCGGTGATTCAGCCAGGAACGTTTACTCGAGTAAACGTTCCTGGCTGAATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)