EMAIL THIS PAGE TO A FRIEND

SGOL2

shugoshin-like 2 (S. pombe)

66 Gene Product Result for
Synonyms: SGO2 TRIPIN
Gene ID:
Mouse(68549) shugoshin-like 2 (S. pombe)
Rat(316425) shugoshin-like 2 (S. pombe)
chicken(424070) shugoshin-like 2 (S. pombe)
dog(478863) shugoshin-like 2 (S. pombe)
Horse(100070958) shugoshin-like 2 (S. pombe)
domestic cat(101091719) shugoshin-like 2 (S. pombe)
naked mole-rat(101724206) shugoshin-like 2 (S. pombe)
domestic guinea pig(100720489) shugoshin-like 2 (S. pombe)
cow(532412) shugoshin-like 2 (S. pombe)
sheep(101104300) shugoshin-like 2 (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0021 AQUA Peptide ILNNSSIF[K] dog, human, mouse, rat pricing
AQ0020 AQUA Peptide LNFENTFL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152524 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152524 Rosetta Predictions human pricing
XM_001068385 Rosetta Predictions rat pricing
XM_237176 Rosetta Predictions rat pricing
NM_199007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062472 predicted 756
2 SASI_Hs01_00062473 predicted 2451
3 SASI_Hs01_00062475 predicted 2911
4 SASI_Hs02_00366319 predicted 364
5 SASI_Hs01_00062476 predicted 2497
6 SASI_Hs01_00062477 predicted 462
7 SASI_Hs01_00062478 predicted 3661
8 SASI_Hs01_00062479 predicted 796
9 SASI_Hs01_00062480 predicted 819
10 SASI_Hs01_00062481 predicted 610
11 SASI_Hs01_00062474 predicted 2214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324372 predicted 3000
2 SASI_Rn02_00324373 predicted 2999
3 SASI_Rn02_00324374 predicted 3020
4 SASI_Rn02_00324375 predicted 911
5 SASI_Rn02_00324376 predicted 3073
6 SASI_Rn02_00324377 predicted 2986
7 SASI_Rn02_00324378 predicted 2562
8 SASI_Rn02_00324379 predicted 860
9 SASI_Rn02_00324380 predicted 1031
10 SASI_Rn02_00324381 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390697 predicted 3007
2 SASI_Rn02_00390698 predicted 2998
3 SASI_Rn02_00390699 predicted 3025
4 SASI_Rn02_00390700 predicted 906
5 SASI_Rn02_00390701 predicted 3072
6 SASI_Rn02_00390702 predicted 2986
7 SASI_Rn02_00390703 predicted 2554
8 SASI_Rn02_00390704 predicted 855
9 SASI_Rn02_00390705 predicted 1027
10 SASI_Rn02_00390706 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130511 predicted 543
2 SASI_Mm01_00130512 predicted 2054
3 SASI_Mm01_00130513 predicted 1886
4 SASI_Mm01_00130514 predicted 2493
5 SASI_Mm01_00130515 predicted 3360
6 SASI_Mm01_00130516 predicted 802
7 SASI_Mm01_00130517 predicted 853
8 SASI_Mm01_00130518 predicted 840
9 SASI_Mm02_00351254 predicted 2942
10 SASI_Mm01_00130520 predicted 2785
11 SASI_Mm01_00130519 predicted 2677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199007
VALIDATED
SGOL2 MISSION shRNA Bacterial Glycerol Stock
shugoshin-like 2 (S. pombe)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000451084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199007.2-2885s21c1
Sequence:CCGGTATCAAAGATTGCGAAGATATCTCGAGATATCTTCGCAATCTTTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199007.2-4013s21c1
Sequence:CCGGATGTGCATGAAATAGCTATATCTCGAGATATAGCTATTTCATGCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199007.2-4068s21c1
Sequence:CCGGCATCACATAACTTGTTGATTTCTCGAGAAATCAACAAGTTATGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-2507s1c1
Sequence:CCGGCGTGTGATTATAAGTCTGAAACTCGAGTTTCAGACTTATAATCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-4685s1c1
Sequence:CCGGGCTCGTATCTATCTACTGATTCTCGAGAATCAGTAGATAGATACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-839s1c1
Sequence:CCGGCATCCTTACATCAGTGCAATTCTCGAGAATTGCACTGATGTAAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-2590s1c1
Sequence:CCGGGCAGGTAAGAAACTTAGACAACTCGAGTTGTCTAAGTTTCTTACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-1263s1c1
Sequence:CCGGGCAGAAGAACACCGATAGCTTCTCGAGAAGCTATCGGTGTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199007.2-2007s21c1
Sequence:CCGGGATCTTTCCATCGAAGCTAATCTCGAGATTAGCTTCGATGGAAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199007
VALIDATED
SGOL2 MISSION shRNA shRNA Plasmid DNA
shugoshin-like 2 (S. pombe)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000451084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199007.2-2885s21c1
Sequence:CCGGTATCAAAGATTGCGAAGATATCTCGAGATATCTTCGCAATCTTTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199007.2-4013s21c1
Sequence:CCGGATGTGCATGAAATAGCTATATCTCGAGATATAGCTATTTCATGCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199007.2-4068s21c1
Sequence:CCGGCATCACATAACTTGTTGATTTCTCGAGAAATCAACAAGTTATGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-2507s1c1
Sequence:CCGGCGTGTGATTATAAGTCTGAAACTCGAGTTTCAGACTTATAATCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-4685s1c1
Sequence:CCGGGCTCGTATCTATCTACTGATTCTCGAGAATCAGTAGATAGATACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-839s1c1
Sequence:CCGGCATCCTTACATCAGTGCAATTCTCGAGAATTGCACTGATGTAAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-2590s1c1
Sequence:CCGGGCAGGTAAGAAACTTAGACAACTCGAGTTGTCTAAGTTTCTTACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-1263s1c1
Sequence:CCGGGCAGAAGAACACCGATAGCTTCTCGAGAAGCTATCGGTGTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199007.2-2007s21c1
Sequence:CCGGGATCTTTCCATCGAAGCTAATCTCGAGATTAGCTTCGATGGAAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199007
VALIDATED
SGOL2 MISSION shRNA Lentiviral Transduction Particles
shugoshin-like 2 (S. pombe)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000451084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199007.2-2885s21c1
Sequence:CCGGTATCAAAGATTGCGAAGATATCTCGAGATATCTTCGCAATCTTTGATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199007.2-4013s21c1
Sequence:CCGGATGTGCATGAAATAGCTATATCTCGAGATATAGCTATTTCATGCACATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199007.2-4068s21c1
Sequence:CCGGCATCACATAACTTGTTGATTTCTCGAGAAATCAACAAGTTATGTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-2507s1c1
Sequence:CCGGCGTGTGATTATAAGTCTGAAACTCGAGTTTCAGACTTATAATCACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-4685s1c1
Sequence:CCGGGCTCGTATCTATCTACTGATTCTCGAGAATCAGTAGATAGATACGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-839s1c1
Sequence:CCGGCATCCTTACATCAGTGCAATTCTCGAGAATTGCACTGATGTAAGGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-2590s1c1
Sequence:CCGGGCAGGTAAGAAACTTAGACAACTCGAGTTGTCTAAGTTTCTTACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199007.1-1263s1c1
Sequence:CCGGGCAGAAGAACACCGATAGCTTCTCGAGAAGCTATCGGTGTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199007.2-2007s21c1
Sequence:CCGGGATCTTTCCATCGAAGCTAATCTCGAGATTAGCTTCGATGGAAAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152524
VALIDATED
SGOL2 MISSION shRNA Bacterial Glycerol Stock
shugoshin-like 2 (S. pombe)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-2410s1c2
Sequence:CCGGGCCATGATATGCAACCTGCTTCTCGAGAAGCAGGTTGCATATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1041s21c1
Sequence:CCGGGAGATAAATGGTCATACTAATCTCGAGATTAGTATGACCATTTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1862s21c1
Sequence:CCGGTTATGGGACCCACAATATATTCTCGAGAATATATTGTGGGTCCCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-3535s21c1
Sequence:CCGGAGATACATTCACCTAACATACCTCGAGGTATGTTAGGTGAATGTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-424s21c1
Sequence:CCGGATAAGAAGCTTATAGACATAGCTCGAGCTATGTCTATAAGCTTCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-576s21c1
Sequence:CCGGCCATTTGCAAGGGTTCCATTACTCGAGTAATGGAACCCTTGCAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152524.3-3953s1c1
Sequence:CCGGCCTTTCATGGAGTGTTGATTTCTCGAGAAATCAACACTCCATGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152524.3-1535s1c1
Sequence:CCGGGCAAGAGGAAACATACTCTTTCTCGAGAAAGAGTATGTTTCCTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-3582s1c1
Sequence:CCGGCCAGCCTTTCAAGTAAGTGATCTCGAGATCACTTACTTGAAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-457s1c1
Sequence:CCGGGCAAGAAGAAACGAATTAGTACTCGAGTACTAATTCGTTTCTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-657s21c1
Sequence:CCGGTCAAAGACATTACCTGATATTCTCGAGAATATCAGGTAATGTCTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1369s21c1
Sequence:CCGGATAGTTCAGATGTCGATATTGCTCGAGCAATATCGACATCTGAACTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152524
VALIDATED
SGOL2 MISSION shRNA shRNA Plasmid DNA
shugoshin-like 2 (S. pombe)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-2410s1c2
Sequence:CCGGGCCATGATATGCAACCTGCTTCTCGAGAAGCAGGTTGCATATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1041s21c1
Sequence:CCGGGAGATAAATGGTCATACTAATCTCGAGATTAGTATGACCATTTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1862s21c1
Sequence:CCGGTTATGGGACCCACAATATATTCTCGAGAATATATTGTGGGTCCCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-3535s21c1
Sequence:CCGGAGATACATTCACCTAACATACCTCGAGGTATGTTAGGTGAATGTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-424s21c1
Sequence:CCGGATAAGAAGCTTATAGACATAGCTCGAGCTATGTCTATAAGCTTCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-576s21c1
Sequence:CCGGCCATTTGCAAGGGTTCCATTACTCGAGTAATGGAACCCTTGCAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152524.3-3953s1c1
Sequence:CCGGCCTTTCATGGAGTGTTGATTTCTCGAGAAATCAACACTCCATGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152524.3-1535s1c1
Sequence:CCGGGCAAGAGGAAACATACTCTTTCTCGAGAAAGAGTATGTTTCCTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-3582s1c1
Sequence:CCGGCCAGCCTTTCAAGTAAGTGATCTCGAGATCACTTACTTGAAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-457s1c1
Sequence:CCGGGCAAGAAGAAACGAATTAGTACTCGAGTACTAATTCGTTTCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-657s21c1
Sequence:CCGGTCAAAGACATTACCTGATATTCTCGAGAATATCAGGTAATGTCTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1369s21c1
Sequence:CCGGATAGTTCAGATGTCGATATTGCTCGAGCAATATCGACATCTGAACTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152524
VALIDATED
SGOL2 MISSION shRNA Lentiviral Transduction Particles
shugoshin-like 2 (S. pombe)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-2410s1c2
Sequence:CCGGGCCATGATATGCAACCTGCTTCTCGAGAAGCAGGTTGCATATCATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1041s21c1
Sequence:CCGGGAGATAAATGGTCATACTAATCTCGAGATTAGTATGACCATTTATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1862s21c1
Sequence:CCGGTTATGGGACCCACAATATATTCTCGAGAATATATTGTGGGTCCCATAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-3535s21c1
Sequence:CCGGAGATACATTCACCTAACATACCTCGAGGTATGTTAGGTGAATGTATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-424s21c1
Sequence:CCGGATAAGAAGCTTATAGACATAGCTCGAGCTATGTCTATAAGCTTCTTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-576s21c1
Sequence:CCGGCCATTTGCAAGGGTTCCATTACTCGAGTAATGGAACCCTTGCAAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152524.3-3953s1c1
Sequence:CCGGCCTTTCATGGAGTGTTGATTTCTCGAGAAATCAACACTCCATGAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152524.3-1535s1c1
Sequence:CCGGGCAAGAGGAAACATACTCTTTCTCGAGAAAGAGTATGTTTCCTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-3582s1c1
Sequence:CCGGCCAGCCTTTCAAGTAAGTGATCTCGAGATCACTTACTTGAAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152524.3-457s1c1
Sequence:CCGGGCAAGAAGAAACGAATTAGTACTCGAGTACTAATTCGTTTCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-657s21c1
Sequence:CCGGTCAAAGACATTACCTGATATTCTCGAGAATATCAGGTAATGTCTTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152524.5-1369s21c1
Sequence:CCGGATAGTTCAGATGTCGATATTGCTCGAGCAATATCGACATCTGAACTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)