EMAIL THIS PAGE TO A FRIEND

SGPL1

sphingosine-1-phosphate lyase 1

76 Gene Product Result for
Synonyms: S1PL SPL
UniProtKB ID: O95470, B2RBD4, Q7Z732, Q9ULG8, Q9UN89
Gene ID:
Mouse(20397) sphingosine phosphate lyase 1
Rat(286896) sphingosine-1-phosphate lyase 1
cow(522515) sphingosine-1-phosphate lyase 1
sheep(101111155) sphingosine-1-phosphate lyase 1
Goat(100861080) sphingosine-1-phosphate lyase 1
domestic guinea pig(100722554) sphingosine-1-phosphate lyase 1
naked mole-rat(101719478) sphingosine-1-phosphate lyase 1
Domestic Rabbit(100338930) sphingosine-1-phosphate lyase 1
Zebrafish(100037312) sphingosine-1-phosphate lyase 1
Horse(100072755) sphingosine-1-phosphate lyase 1
domestic cat(101096919) sphingosine-1-phosphate lyase 1
dog(489032) sphingosine-1-phosphate lyase 1
chicken(423714) sphingosine-1-phosphate lyase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003901 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003901 Rosetta Predictions human pricing
NM_173116 Rosetta Predictions rat pricing
NM_009163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336527 predicted 461
2 SASI_Hs01_00106806 predicted 767
3 SASI_Hs01_00106807 predicted 1792
4 SASI_Hs01_00106809 predicted 396
5 SASI_Hs01_00106810 predicted 1209
6 SASI_Hs01_00106811 predicted 1323
7 SASI_Hs01_00106812 predicted 1291
8 SASI_Hs01_00106813 predicted 314
9 SASI_Hs01_00106814 predicted 1735
10 SASI_Hs01_00106815 predicted 237
11 SASI_Hs01_00106808 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068769 predicted 366
2 SASI_Rn01_00068770 predicted 1237
3 SASI_Rn01_00068771 predicted 286
4 SASI_Rn01_00068772 predicted 403
5 SASI_Rn01_00068773 predicted 314
6 SASI_Rn01_00068774 predicted 1130
7 SASI_Rn01_00068775 predicted 1503
8 SASI_Rn01_00068776 predicted 870
9 SASI_Rn01_00068777 predicted 350
10 SASI_Rn01_00068778 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122643 predicted 1643
2 SASI_Mm01_00122644 predicted 1658
3 SASI_Mm01_00122645 predicted 1512
4 SASI_Mm01_00122646 predicted 1138
5 SASI_Mm01_00122647 predicted 1374
6 SASI_Mm02_00315510 predicted 1363
7 SASI_Mm01_00122648 predicted 1218
8 SASI_Mm01_00122649 predicted 1660
9 SASI_Mm01_00122650 predicted 1172
10 SASI_Mm01_00122651 predicted 997
11 SASI_Mm01_00122652 predicted 1523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009163
VALIDATED
SGPL1 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate lyase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009163.3-2166s21c1
Sequence:CCGGGCATCGTCTTTACTTAATCATCTCGAGATGATTAAGTAAAGACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009163.3-1999s21c1
Sequence:CCGGGCACAATAGGATAAACCATAACTCGAGTTATGGTTTATCCTATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009163.3-217s21c1
Sequence:CCGGGAAGGACTTCGAGCCTTATTTCTCGAGAAATAAGGCTCGAAGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-163s1c1
Sequence:CCGGGAAGGACTTCGAGCCTTATTTCTCGAGAAATAAGGCTCGAAGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-1945s1c1
Sequence:CCGGGCACAATAGGATAAACCATAACTCGAGTTATGGTTTATCCTATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009163.3-451s21c1
Sequence:CCGGGATCGAACAACAGGTGAGCAACTCGAGTTGCTCACCTGTTGTTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-397s1c1
Sequence:CCGGGATCGAACAACAGGTGAGCAACTCGAGTTGCTCACCTGTTGTTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-2112s1c1
Sequence:CCGGGCATCGTCTTTACTTAATCATCTCGAGATGATTAAGTAAAGACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009163
VALIDATED
SGPL1 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate lyase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009163.3-2166s21c1
Sequence:CCGGGCATCGTCTTTACTTAATCATCTCGAGATGATTAAGTAAAGACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009163.3-1999s21c1
Sequence:CCGGGCACAATAGGATAAACCATAACTCGAGTTATGGTTTATCCTATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009163.3-217s21c1
Sequence:CCGGGAAGGACTTCGAGCCTTATTTCTCGAGAAATAAGGCTCGAAGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-163s1c1
Sequence:CCGGGAAGGACTTCGAGCCTTATTTCTCGAGAAATAAGGCTCGAAGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-1945s1c1
Sequence:CCGGGCACAATAGGATAAACCATAACTCGAGTTATGGTTTATCCTATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009163.3-451s21c1
Sequence:CCGGGATCGAACAACAGGTGAGCAACTCGAGTTGCTCACCTGTTGTTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-397s1c1
Sequence:CCGGGATCGAACAACAGGTGAGCAACTCGAGTTGCTCACCTGTTGTTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-2112s1c1
Sequence:CCGGGCATCGTCTTTACTTAATCATCTCGAGATGATTAAGTAAAGACGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009163
VALIDATED
SGPL1 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate lyase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009163.3-2166s21c1
Sequence:CCGGGCATCGTCTTTACTTAATCATCTCGAGATGATTAAGTAAAGACGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009163.3-1999s21c1
Sequence:CCGGGCACAATAGGATAAACCATAACTCGAGTTATGGTTTATCCTATTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009163.3-217s21c1
Sequence:CCGGGAAGGACTTCGAGCCTTATTTCTCGAGAAATAAGGCTCGAAGTCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-163s1c1
Sequence:CCGGGAAGGACTTCGAGCCTTATTTCTCGAGAAATAAGGCTCGAAGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174945    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-1945s1c1
Sequence:CCGGGCACAATAGGATAAACCATAACTCGAGTTATGGTTTATCCTATTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009163.3-451s21c1
Sequence:CCGGGATCGAACAACAGGTGAGCAACTCGAGTTGCTCACCTGTTGTTCGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-397s1c1
Sequence:CCGGGATCGAACAACAGGTGAGCAACTCGAGTTGCTCACCTGTTGTTCGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009163.2-2112s1c1
Sequence:CCGGGCATCGTCTTTACTTAATCATCTCGAGATGATTAAGTAAAGACGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003901
VALIDATED
SGPL1 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate lyase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003901.3-2326s21c1
Sequence:CCGGGCGTTTACATAACAGATGTTTCTCGAGAAACATCTGTTATGTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-450s1c1
Sequence:CCGGGATGCCCATTATTGGTCGTAACTCGAGTTACGACCAATAATGGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-2314s1c1
Sequence:CCGGGCGTTTACATAACAGATGTTTCTCGAGAAACATCTGTTATGTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-1886s1c1
Sequence:CCGGGCCAGATGAATGGTTCTCCAACTCGAGTTGGAGAACCATTCATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-733s1c1
Sequence:CCGGCCAGATATCTTCCCAGGACTACTCGAGTAGTCCTGGGAAGATATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-453s1c1
Sequence:CCGGGCCCATTATTGGTCGTAAGATCTCGAGATCTTACGACCAATAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003901.3-1898s21c1
Sequence:CCGGGCCAGATGAATGGTTCTCCAACTCGAGTTGGAGAACCATTCATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-465s21c1
Sequence:CCGGGCCCATTATTGGTCGTAAGATCTCGAGATCTTACGACCAATAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-1575s21c1
Sequence:CCGGTGCTCTGGGATCCCGTGATTTCTCGAGAAATCACGGGATCCCAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-1697s21c1
Sequence:CCGGCCCGGAAACGAGTAGCTATACCTCGAGGTATAGCTACTCGTTTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003901
VALIDATED
SGPL1 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate lyase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003901.3-2326s21c1
Sequence:CCGGGCGTTTACATAACAGATGTTTCTCGAGAAACATCTGTTATGTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-450s1c1
Sequence:CCGGGATGCCCATTATTGGTCGTAACTCGAGTTACGACCAATAATGGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-2314s1c1
Sequence:CCGGGCGTTTACATAACAGATGTTTCTCGAGAAACATCTGTTATGTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-1886s1c1
Sequence:CCGGGCCAGATGAATGGTTCTCCAACTCGAGTTGGAGAACCATTCATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-733s1c1
Sequence:CCGGCCAGATATCTTCCCAGGACTACTCGAGTAGTCCTGGGAAGATATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-453s1c1
Sequence:CCGGGCCCATTATTGGTCGTAAGATCTCGAGATCTTACGACCAATAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003901.3-1898s21c1
Sequence:CCGGGCCAGATGAATGGTTCTCCAACTCGAGTTGGAGAACCATTCATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-465s21c1
Sequence:CCGGGCCCATTATTGGTCGTAAGATCTCGAGATCTTACGACCAATAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-1575s21c1
Sequence:CCGGTGCTCTGGGATCCCGTGATTTCTCGAGAAATCACGGGATCCCAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-1697s21c1
Sequence:CCGGCCCGGAAACGAGTAGCTATACCTCGAGGTATAGCTACTCGTTTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003901
VALIDATED
SGPL1 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate lyase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003901.3-2326s21c1
Sequence:CCGGGCGTTTACATAACAGATGTTTCTCGAGAAACATCTGTTATGTAAACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-450s1c1
Sequence:CCGGGATGCCCATTATTGGTCGTAACTCGAGTTACGACCAATAATGGGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-2314s1c1
Sequence:CCGGGCGTTTACATAACAGATGTTTCTCGAGAAACATCTGTTATGTAAACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-1886s1c1
Sequence:CCGGGCCAGATGAATGGTTCTCCAACTCGAGTTGGAGAACCATTCATCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-733s1c1
Sequence:CCGGCCAGATATCTTCCCAGGACTACTCGAGTAGTCCTGGGAAGATATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003901.2-453s1c1
Sequence:CCGGGCCCATTATTGGTCGTAAGATCTCGAGATCTTACGACCAATAATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003901.3-1898s21c1
Sequence:CCGGGCCAGATGAATGGTTCTCCAACTCGAGTTGGAGAACCATTCATCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-465s21c1
Sequence:CCGGGCCCATTATTGGTCGTAAGATCTCGAGATCTTACGACCAATAATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-1575s21c1
Sequence:CCGGTGCTCTGGGATCCCGTGATTTCTCGAGAAATCACGGGATCCCAGAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003901.3-1697s21c1
Sequence:CCGGCCCGGAAACGAGTAGCTATACCTCGAGGTATAGCTACTCGTTTCCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)