EMAIL THIS PAGE TO A FRIEND

SGPP1

sphingosine-1-phosphate phosphatase 1

176 Gene Product Result for
Synonyms: SPPase1
UniProtKB ID: Q9BX95, B2RAH0, Q9H189
Gene ID:
Human(81537) Summary: Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP1 catalyzes the degradation of S1P via salvage and recycling of sphingosine into long-chain ceramides (Mandala et al., 2000 [PubMed 10859351]
Mouse(81535) sphingosine-1-phosphate phosphatase 1
Rat(81536) sphingosine-1-phosphate phosphatase 1
Zebrafish(100003745) sphingosine-1-phosphate phosphatase 1
chicken(428918) sphingosine-1-phosphate phosphatase 1
dog(490728) sphingosine-1-phosphate phosphatase 1
naked mole-rat(101710628) sphingosine-1-phosphate phosphatase 1
domestic guinea pig(100715609) sphingosine-1-phosphate phosphatase 1
cow(516881) sphingosine-1-phosphate phosphatase 1
sheep(101108492) sphingosine-1-phosphate phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030791 Rosetta Predictions human pricing
XM_001080791 Rosetta Predictions rat pricing
XM_343081 Rosetta Predictions rat pricing
NM_030750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184750 predicted 1222
2 SASI_Hs01_00184751 predicted 1097
3 SASI_Hs01_00184753 predicted 1408
4 SASI_Hs01_00184754 predicted 962
5 SASI_Hs01_00184755 predicted 820
6 SASI_Hs01_00184756 predicted 948
7 SASI_Hs01_00184757 predicted 1443
8 SASI_Hs01_00184758 predicted 801
9 SASI_Hs01_00184759 predicted 850
10 SASI_Hs02_00358343 predicted 1319
11 SASI_Hs01_00184752 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369382 predicted 1268
2 SASI_Rn02_00369383 predicted 912
3 SASI_Rn02_00369384 predicted 1380
4 SASI_Rn02_00369385 predicted 938
5 SASI_Rn02_00369386 predicted 1350
6 SASI_Rn02_00369387 predicted 967
7 SASI_Rn02_00369388 predicted 1354
8 SASI_Rn02_00369389 predicted 1460
9 SASI_Rn02_00369390 predicted 1326
10 SASI_Rn02_00369391 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395281 predicted 1259
2 SASI_Rn02_00395282 predicted 908
3 SASI_Rn02_00395283 predicted 1373
4 SASI_Rn02_00395284 predicted 935
5 SASI_Rn02_00395285 predicted 1355
6 SASI_Rn02_00395286 predicted 967
7 SASI_Rn02_00395287 predicted 1350
8 SASI_Rn02_00395288 predicted 1457
9 SASI_Rn02_00395289 predicted 1322
10 SASI_Rn02_00395290 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160822 predicted 963
2 SASI_Mm01_00160823 predicted 1248
3 SASI_Mm01_00160824 predicted 1152
4 SASI_Mm01_00160825 predicted 453
5 SASI_Mm01_00160826 predicted 670
6 SASI_Mm01_00160827 predicted 1123
7 SASI_Mm01_00160828 predicted 790
8 SASI_Mm01_00160829 predicted 1236
9 SASI_Mm01_00160830 predicted 769
10 SASI_Mm01_00160831 predicted 1274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030791
VALIDATED
SGPP1 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate phosphatase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1903s21c1
Sequence:CCGGTCCTAATTGAATTGCGTAATTCTCGAGAATTACGCAATTCAATTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030791.2-1594s21c1
Sequence:CCGGTTAGGTGAGCTGAGCTATTTCCTCGAGGAAATAGCTCAGCTCACCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030791.2-1328s21c1
Sequence:CCGGGAACTTCCTTATCGGTATATTCTCGAGAATATACCGATAAGGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-856s21c1
Sequence:CCGGGCACTCTATTCTGGATATTATCTCGAGATAATATCCAGAATAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1209s21c1
Sequence:CCGGGGATGGTATTTGTACTAATAACTCGAGTTATTAGTACAAATACCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-1334s1c1
Sequence:CCGGCCTTATCGGTATATTACCTATCTCGAGATAGGTAATATACCGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030791.2-878s1c1
Sequence:CCGGGCTGGATTCCTATATACCATTCTCGAGAATGGTATATAGGAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-1115s1c1
Sequence:CCGGCTAGTATTAGATCCTTCTCTACTCGAGTAGAGAAGGATCTAATACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-782s1c1
Sequence:CCGGCCTCTTATATATGGACTGATTCTCGAGAATCAGTCCATATATAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1124s21c1
Sequence:CCGGGATCCTTCTCTAGATACATTACTCGAGTAATGTATCTAGAGAAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-968s1c1
Sequence:CCGGCCATTCATCATCATCGGGCTTCTCGAGAAGCCCGATGATGATGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030791
VALIDATED
SGPP1 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate phosphatase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1903s21c1
Sequence:CCGGTCCTAATTGAATTGCGTAATTCTCGAGAATTACGCAATTCAATTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030791.2-1594s21c1
Sequence:CCGGTTAGGTGAGCTGAGCTATTTCCTCGAGGAAATAGCTCAGCTCACCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030791.2-1328s21c1
Sequence:CCGGGAACTTCCTTATCGGTATATTCTCGAGAATATACCGATAAGGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-856s21c1
Sequence:CCGGGCACTCTATTCTGGATATTATCTCGAGATAATATCCAGAATAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1209s21c1
Sequence:CCGGGGATGGTATTTGTACTAATAACTCGAGTTATTAGTACAAATACCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-1334s1c1
Sequence:CCGGCCTTATCGGTATATTACCTATCTCGAGATAGGTAATATACCGATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030791.2-878s1c1
Sequence:CCGGGCTGGATTCCTATATACCATTCTCGAGAATGGTATATAGGAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-1115s1c1
Sequence:CCGGCTAGTATTAGATCCTTCTCTACTCGAGTAGAGAAGGATCTAATACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-782s1c1
Sequence:CCGGCCTCTTATATATGGACTGATTCTCGAGAATCAGTCCATATATAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1124s21c1
Sequence:CCGGGATCCTTCTCTAGATACATTACTCGAGTAATGTATCTAGAGAAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-968s1c1
Sequence:CCGGCCATTCATCATCATCGGGCTTCTCGAGAAGCCCGATGATGATGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030791
VALIDATED
SGPP1 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate phosphatase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1903s21c1
Sequence:CCGGTCCTAATTGAATTGCGTAATTCTCGAGAATTACGCAATTCAATTAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030791.2-1594s21c1
Sequence:CCGGTTAGGTGAGCTGAGCTATTTCCTCGAGGAAATAGCTCAGCTCACCTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030791.2-1328s21c1
Sequence:CCGGGAACTTCCTTATCGGTATATTCTCGAGAATATACCGATAAGGAAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-856s21c1
Sequence:CCGGGCACTCTATTCTGGATATTATCTCGAGATAATATCCAGAATAGAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1209s21c1
Sequence:CCGGGGATGGTATTTGTACTAATAACTCGAGTTATTAGTACAAATACCATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-1334s1c1
Sequence:CCGGCCTTATCGGTATATTACCTATCTCGAGATAGGTAATATACCGATAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030791.2-878s1c1
Sequence:CCGGGCTGGATTCCTATATACCATTCTCGAGAATGGTATATAGGAATCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-1115s1c1
Sequence:CCGGCTAGTATTAGATCCTTCTCTACTCGAGTAGAGAAGGATCTAATACTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-782s1c1
Sequence:CCGGCCTCTTATATATGGACTGATTCTCGAGAATCAGTCCATATATAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030791.2-1124s21c1
Sequence:CCGGGATCCTTCTCTAGATACATTACTCGAGTAATGTATCTAGAGAAGGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030791.2-968s1c1
Sequence:CCGGCCATTCATCATCATCGGGCTTCTCGAGAAGCCCGATGATGATGAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030750
VALIDATED
SGPP1 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate phosphatase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-1257s21c1
Sequence:CCGGGCCTGTAAACTCTCCAGTATTCTCGAGAATACTGGAGAGTTTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-1331s21c1
Sequence:CCGGCCGGTATATTACCTACGGGATCTCGAGATCCCGTAGGTAATATACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-857s21c1
Sequence:CCGGCCTGGATGTCATTGCTGGATTCTCGAGAATCCAGCAATGACATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1257s1c1
Sequence:CCGGGCCTGTAAACTCTCCAGTATTCTCGAGAATACTGGAGAGTTTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1331s1c1
Sequence:CCGGCCGGTATATTACCTACGGGATCTCGAGATCCCGTAGGTAATATACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-857s1c1
Sequence:CCGGCCTGGATGTCATTGCTGGATTCTCGAGAATCCAGCAATGACATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-774s1c1
Sequence:CCGGCCTCTTATCTACGGGCTGATTCTCGAGAATCAGCCCGTAGATAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1609s1c1
Sequence:CCGGCCACTTAGAATGTTCACCAAACTCGAGTTTGGTGAACATTCTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-774s21c1
Sequence:CCGGCCTCTTATCTACGGGCTGATTCTCGAGAATCAGCCCGTAGATAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030750
VALIDATED
SGPP1 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate phosphatase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-1257s21c1
Sequence:CCGGGCCTGTAAACTCTCCAGTATTCTCGAGAATACTGGAGAGTTTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-1331s21c1
Sequence:CCGGCCGGTATATTACCTACGGGATCTCGAGATCCCGTAGGTAATATACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-857s21c1
Sequence:CCGGCCTGGATGTCATTGCTGGATTCTCGAGAATCCAGCAATGACATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1257s1c1
Sequence:CCGGGCCTGTAAACTCTCCAGTATTCTCGAGAATACTGGAGAGTTTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1331s1c1
Sequence:CCGGCCGGTATATTACCTACGGGATCTCGAGATCCCGTAGGTAATATACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-857s1c1
Sequence:CCGGCCTGGATGTCATTGCTGGATTCTCGAGAATCCAGCAATGACATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-774s1c1
Sequence:CCGGCCTCTTATCTACGGGCTGATTCTCGAGAATCAGCCCGTAGATAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1609s1c1
Sequence:CCGGCCACTTAGAATGTTCACCAAACTCGAGTTTGGTGAACATTCTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-774s21c1
Sequence:CCGGCCTCTTATCTACGGGCTGATTCTCGAGAATCAGCCCGTAGATAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030750
VALIDATED
SGPP1 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate phosphatase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-1257s21c1
Sequence:CCGGGCCTGTAAACTCTCCAGTATTCTCGAGAATACTGGAGAGTTTACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-1331s21c1
Sequence:CCGGCCGGTATATTACCTACGGGATCTCGAGATCCCGTAGGTAATATACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-857s21c1
Sequence:CCGGCCTGGATGTCATTGCTGGATTCTCGAGAATCCAGCAATGACATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1257s1c1
Sequence:CCGGGCCTGTAAACTCTCCAGTATTCTCGAGAATACTGGAGAGTTTACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1331s1c1
Sequence:CCGGCCGGTATATTACCTACGGGATCTCGAGATCCCGTAGGTAATATACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-857s1c1
Sequence:CCGGCCTGGATGTCATTGCTGGATTCTCGAGAATCCAGCAATGACATCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-774s1c1
Sequence:CCGGCCTCTTATCTACGGGCTGATTCTCGAGAATCAGCCCGTAGATAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030750.2-1609s1c1
Sequence:CCGGCCACTTAGAATGTTCACCAAACTCGAGTTTGGTGAACATTCTAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030750.2-774s21c1
Sequence:CCGGCCTCTTATCTACGGGCTGATTCTCGAGAATCAGCCCGTAGATAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)