EMAIL THIS PAGE TO A FRIEND

SGPP2

sphingosine-1-phosphate phosphatase 2

63 Gene Product Result for
Synonyms: SPP2
UniProtKB ID: Q8IWX5, A3KPB4, Q8N8Q6
Gene ID:
Human(130367) Summary: Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P (Ogawa et al., 2003 [PubMed 12411432]
Mouse(433323) sphingosine-1-phosphate phosphotase 2
Rat(301543) sphingosine-1-phosphate phosphatase 2
cow(100337041) sphingosine-1-phosphate phosphatase 2
sheep(101116130) sphingosine-1-phosphate phosphatase 2
domestic guinea pig(100731261) sphingosine-1-phosphate phosphatase 2
naked mole-rat(101701693) sphingosine-1-phosphate phosphatase 2
chicken(424813) sphingosine-1-phosphate phosphatase 2
dog(610884) sphingosine-1-phosphate phosphatase 2
Horse(100060934) sphingosine-1-phosphate phosphatase 2
domestic cat(101083024) sphingosine-1-phosphate phosphatase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108592 Anti-SGPP2 IgG fraction of antiserum human
immunohistochemistry, western blot pricing
AV45734 Anti-SGPP2 antibody produced in rabbit IgG fraction of antiserum guinea pig, rabbit, horse, mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152386 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152386 Rosetta Predictions human pricing
XM_001063326 Rosetta Predictions rat pricing
XM_237343 Rosetta Predictions rat pricing
NM_001004173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134589 predicted 762
2 SASI_Hs02_00366052 predicted 335
3 SASI_Hs01_00134592 predicted 232
4 SASI_Hs01_00134593 predicted 548
5 SASI_Hs01_00134594 predicted 779
6 SASI_Hs01_00134595 predicted 876
7 SASI_Hs01_00134596 predicted 543
8 SASI_Hs01_00134597 predicted 974
9 SASI_Hs02_00366053 predicted 289
10 SASI_Hs02_00366054 predicted 612
11 SASI_Hs01_00134590 predicted 355
12 SASI_Hs01_00134591 predicted 865
13 SASI_Hs01_00134598 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306680 predicted 661
2 SASI_Rn02_00306681 predicted 207
3 SASI_Rn02_00306682 predicted 777
4 SASI_Rn02_00306683 predicted 370
5 SASI_Rn02_00306684 predicted 245
6 SASI_Rn02_00306685 predicted 276
7 SASI_Rn02_00306686 predicted 485
8 SASI_Rn02_00306687 predicted 784
9 SASI_Rn02_00306688 predicted 242
10 SASI_Rn02_00306689 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390837 predicted 377
2 SASI_Rn02_00390838 predicted 464
3 SASI_Rn02_00390839 predicted 468
4 SASI_Rn02_00390840 predicted 248
5 SASI_Rn02_00390841 predicted 371
6 SASI_Rn02_00390842 predicted 244
7 SASI_Rn02_00390843 predicted 275
8 SASI_Rn02_00390844 predicted 484
9 SASI_Rn02_00390845 predicted 243
10 SASI_Rn02_00390846 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286485 predicted 1217
2 SASI_Mm02_00286486 predicted 284
3 SASI_Mm02_00286487 predicted 806
4 SASI_Mm02_00286488 predicted 1142
5 SASI_Mm02_00286489 predicted 978
6 SASI_Mm02_00286490 predicted 1184
7 SASI_Mm02_00286491 predicted 482
8 SASI_Mm02_00286492 predicted 266
9 SASI_Mm02_00286493 predicted 1051
10 SASI_Mm02_00286494 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152386
SGPP2 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate phosphatase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-342s1c1
Sequence:CCGGCCCTTATTTATCCAGAAGATTCTCGAGAATCTTCTGGATAAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-237s1c1
Sequence:CCGGCGTCGTGAAGAATTATTTCTACTCGAGTAGAAATAATTCTTCACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-295s1c1
Sequence:CCGGGAAGTGTTCTACATCACGTTTCTCGAGAAACGTGATGTAGAACACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-910s1c1
Sequence:CCGGGCTGAATCTCTCCCTGTTATTCTCGAGAATAACAGGGAGAGATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-1041s1c1
Sequence:CCGGGCAAGTATTATACTCATGGTTCTCGAGAACCATGAGTATAATACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-897s21c1
Sequence:CCGGTGTATCCAAGCCCGCTGAATCCTCGAGGATTCAGCGGGCTTGGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-331s21c1
Sequence:CCGGTGGAATATTGACCCTTATTTACTCGAGTAAATAAGGGTCAATATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-542s21c1
Sequence:CCGGCTATGGACAGATACCAGTATCCTCGAGGATACTGGTATCTGTCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152386
SGPP2 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate phosphatase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-342s1c1
Sequence:CCGGCCCTTATTTATCCAGAAGATTCTCGAGAATCTTCTGGATAAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-237s1c1
Sequence:CCGGCGTCGTGAAGAATTATTTCTACTCGAGTAGAAATAATTCTTCACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-295s1c1
Sequence:CCGGGAAGTGTTCTACATCACGTTTCTCGAGAAACGTGATGTAGAACACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-910s1c1
Sequence:CCGGGCTGAATCTCTCCCTGTTATTCTCGAGAATAACAGGGAGAGATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-1041s1c1
Sequence:CCGGGCAAGTATTATACTCATGGTTCTCGAGAACCATGAGTATAATACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-897s21c1
Sequence:CCGGTGTATCCAAGCCCGCTGAATCCTCGAGGATTCAGCGGGCTTGGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-331s21c1
Sequence:CCGGTGGAATATTGACCCTTATTTACTCGAGTAAATAAGGGTCAATATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-542s21c1
Sequence:CCGGCTATGGACAGATACCAGTATCCTCGAGGATACTGGTATCTGTCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152386
SGPP2 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate phosphatase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-342s1c1
Sequence:CCGGCCCTTATTTATCCAGAAGATTCTCGAGAATCTTCTGGATAAATAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-237s1c1
Sequence:CCGGCGTCGTGAAGAATTATTTCTACTCGAGTAGAAATAATTCTTCACGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-295s1c1
Sequence:CCGGGAAGTGTTCTACATCACGTTTCTCGAGAAACGTGATGTAGAACACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-910s1c1
Sequence:CCGGGCTGAATCTCTCCCTGTTATTCTCGAGAATAACAGGGAGAGATTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152386.2-1041s1c1
Sequence:CCGGGCAAGTATTATACTCATGGTTCTCGAGAACCATGAGTATAATACTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-897s21c1
Sequence:CCGGTGTATCCAAGCCCGCTGAATCCTCGAGGATTCAGCGGGCTTGGATACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-331s21c1
Sequence:CCGGTGGAATATTGACCCTTATTTACTCGAGTAAATAAGGGTCAATATTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152386.2-542s21c1
Sequence:CCGGCTATGGACAGATACCAGTATCCTCGAGGATACTGGTATCTGTCCATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004173
SGPP2 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate phosphatase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-976s1c1
Sequence:CCGGCCCTGCAAGTATTATTCTCATCTCGAGATGAGAATAATACTTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-281s1c1
Sequence:CCGGCCCTAATTTGTCCAGAAGATTCTCGAGAATCTTCTGGACAAATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004173.1-2184s1c1
Sequence:CCGGGCAGTCTATTTGGAGAGAATACTCGAGTATTCTCTCCAAATAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-708s1c1
Sequence:CCGGCCGTTCCTCTTGTGCTACAATCTCGAGATTGTAGCACAAGAGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-297s1c1
Sequence:CCGGAGATTGGTTGTGATATGGGTTCTCGAGAACCCATATCACAACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004173
SGPP2 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate phosphatase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-976s1c1
Sequence:CCGGCCCTGCAAGTATTATTCTCATCTCGAGATGAGAATAATACTTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-281s1c1
Sequence:CCGGCCCTAATTTGTCCAGAAGATTCTCGAGAATCTTCTGGACAAATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004173.1-2184s1c1
Sequence:CCGGGCAGTCTATTTGGAGAGAATACTCGAGTATTCTCTCCAAATAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-708s1c1
Sequence:CCGGCCGTTCCTCTTGTGCTACAATCTCGAGATTGTAGCACAAGAGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-297s1c1
Sequence:CCGGAGATTGGTTGTGATATGGGTTCTCGAGAACCCATATCACAACCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004173
SGPP2 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate phosphatase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-976s1c1
Sequence:CCGGCCCTGCAAGTATTATTCTCATCTCGAGATGAGAATAATACTTGCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-281s1c1
Sequence:CCGGCCCTAATTTGTCCAGAAGATTCTCGAGAATCTTCTGGACAAATTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004173.1-2184s1c1
Sequence:CCGGGCAGTCTATTTGGAGAGAATACTCGAGTATTCTCTCCAAATAGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-708s1c1
Sequence:CCGGCCGTTCCTCTTGTGCTACAATCTCGAGATTGTAGCACAAGAGGAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004173.1-297s1c1
Sequence:CCGGAGATTGGTTGTGATATGGGTTCTCGAGAACCCATATCACAACCAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)