EMAIL THIS PAGE TO A FRIEND

SGSH

N-sulfoglucosamine sulfohydrolase

107 Gene Product Result for
Synonyms: HSS MPS3A SFMD
UniProtKB ID: P51688, A8K5E2
Gene ID:
Human(6448) Summary: This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(27029) N-sulfoglucosamine sulfohydrolase (sulfamidase)
Rat(688293) N-sulfoglucosamine sulfohydrolase
Zebrafish(563849) N-sulfoglucosamine sulfohydrolase (sulfamidase)
chicken(422081) N-sulfoglucosamine sulfohydrolase
dog(403707) N-sulfoglucosamine sulfohydrolase
domestic cat(101094715) N-sulfoglucosamine sulfohydrolase
naked mole-rat(101720611) N-sulfoglucosamine sulfohydrolase
domestic guinea pig(100728868) N-sulfoglucosamine sulfohydrolase
cow(535442) N-sulfoglucosamine sulfohydrolase
sheep(101121184) N-sulfoglucosamine sulfohydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000199 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000199 Rosetta Predictions human pricing
XM_001081766 Rosetta Predictions rat pricing
NM_018822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302070 predicted 1915
2 SASI_Hs01_00102115 predicted 1233
3 SASI_Hs01_00102116 predicted 1854
4 SASI_Hs02_00302071 predicted 886
5 SASI_Hs01_00102117 predicted 468
6 SASI_Hs01_00102118 predicted 1036
7 SASI_Hs01_00102119 predicted 1619
8 SASI_Hs01_00102120 predicted 936
9 SASI_Hs01_00102121 predicted 1350
10 SASI_Hs01_00102123 predicted 558
11 SASI_Hs01_00102122 predicted 348
12 SASI_Hs01_00102124 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373372 predicted 481
2 SASI_Rn02_00373373 predicted 895
3 SASI_Rn02_00373374 predicted 1301
4 SASI_Rn02_00373375 predicted 1284
5 SASI_Rn02_00373376 predicted 775
6 SASI_Rn02_00373377 predicted 567
7 SASI_Rn02_00373378 predicted 347
8 SASI_Rn02_00373379 predicted 981
9 SASI_Rn02_00373380 predicted 769
10 SASI_Rn02_00373381 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061715 predicted 1577
2 SASI_Mm01_00061717 predicted 1686
3 SASI_Mm01_00061718 predicted 1592
4 SASI_Mm01_00061719 predicted 874
5 SASI_Mm01_00061720 predicted 949
6 SASI_Mm01_00061721 predicted 1166
7 SASI_Mm01_00061722 predicted 975
8 SASI_Mm01_00061723 predicted 273
9 SASI_Mm01_00061724 predicted 1211
10 SASI_Mm02_00324164 predicted 672
11 SASI_Mm01_00061716 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000199
VALIDATED
SGSH MISSION shRNA Bacterial Glycerol Stock
N-sulfoglucosamine sulfohydrolase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-1356s21c1
Sequence:CCGGGTACAAGGACCTCCGTCATTACTCGAGTAATGACGGAGGTCCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-1244s21c1
Sequence:CCGGTCGTGCACAACCTCAACTTCACTCGAGTGAAGTTGAGGTTGTGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000199.3-1708s21c1
Sequence:CCGGTCCCATCCAAGGAGGGTTCTTCTCGAGAAGAACCCTCCTTGGATGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-126s1c1
Sequence:CCGGCGCGTACAACAACAGCGCCATCTCGAGATGGCGCTGTTGTTGTACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000199.2-459s1c1
Sequence:CCGGGCGGAACATCACTAGAATTAACTCGAGTTAATTCTAGTGATGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000199.2-300s1c1
Sequence:CCGGCCACTTCAACTCCTTCGACAACTCGAGTTGTCGAAGGAGTTGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-884s1c1
Sequence:CCGGCTGAACCCTTACTGGTGTCATCTCGAGATGACACCAGTAAGGGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-1179s1c1
Sequence:CCGGCCTCAACTTCAAGATGCCCTTCTCGAGAAGGGCATCTTGAAGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-476s21c1
Sequence:CCGGCCGTGTACCCGTTTGACTTTGCTCGAGCAAAGTCAAACGGGTACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-552s21c1
Sequence:CCGGTAAGCTGCTCGTCCGGAAATTCTCGAGAATTTCCGGACGAGCAGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000199
VALIDATED
SGSH MISSION shRNA shRNA Plasmid DNA
N-sulfoglucosamine sulfohydrolase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-1356s21c1
Sequence:CCGGGTACAAGGACCTCCGTCATTACTCGAGTAATGACGGAGGTCCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-1244s21c1
Sequence:CCGGTCGTGCACAACCTCAACTTCACTCGAGTGAAGTTGAGGTTGTGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000199.3-1708s21c1
Sequence:CCGGTCCCATCCAAGGAGGGTTCTTCTCGAGAAGAACCCTCCTTGGATGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-126s1c1
Sequence:CCGGCGCGTACAACAACAGCGCCATCTCGAGATGGCGCTGTTGTTGTACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000199.2-459s1c1
Sequence:CCGGGCGGAACATCACTAGAATTAACTCGAGTTAATTCTAGTGATGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000199.2-300s1c1
Sequence:CCGGCCACTTCAACTCCTTCGACAACTCGAGTTGTCGAAGGAGTTGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-884s1c1
Sequence:CCGGCTGAACCCTTACTGGTGTCATCTCGAGATGACACCAGTAAGGGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-1179s1c1
Sequence:CCGGCCTCAACTTCAAGATGCCCTTCTCGAGAAGGGCATCTTGAAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-476s21c1
Sequence:CCGGCCGTGTACCCGTTTGACTTTGCTCGAGCAAAGTCAAACGGGTACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-552s21c1
Sequence:CCGGTAAGCTGCTCGTCCGGAAATTCTCGAGAATTTCCGGACGAGCAGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000199
VALIDATED
SGSH MISSION shRNA Lentiviral Transduction Particles
N-sulfoglucosamine sulfohydrolase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-1356s21c1
Sequence:CCGGGTACAAGGACCTCCGTCATTACTCGAGTAATGACGGAGGTCCTTGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-1244s21c1
Sequence:CCGGTCGTGCACAACCTCAACTTCACTCGAGTGAAGTTGAGGTTGTGCACGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000199.3-1708s21c1
Sequence:CCGGTCCCATCCAAGGAGGGTTCTTCTCGAGAAGAACCCTCCTTGGATGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-126s1c1
Sequence:CCGGCGCGTACAACAACAGCGCCATCTCGAGATGGCGCTGTTGTTGTACGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000199.2-459s1c1
Sequence:CCGGGCGGAACATCACTAGAATTAACTCGAGTTAATTCTAGTGATGTTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000199.2-300s1c1
Sequence:CCGGCCACTTCAACTCCTTCGACAACTCGAGTTGTCGAAGGAGTTGAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-884s1c1
Sequence:CCGGCTGAACCCTTACTGGTGTCATCTCGAGATGACACCAGTAAGGGTTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000199.2-1179s1c1
Sequence:CCGGCCTCAACTTCAAGATGCCCTTCTCGAGAAGGGCATCTTGAAGTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-476s21c1
Sequence:CCGGCCGTGTACCCGTTTGACTTTGCTCGAGCAAAGTCAAACGGGTACACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000199.3-552s21c1
Sequence:CCGGTAAGCTGCTCGTCCGGAAATTCTCGAGAATTTCCGGACGAGCAGCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018822
VALIDATED
SGSH MISSION shRNA Bacterial Glycerol Stock
N-sulfoglucosamine sulfohydrolase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018822.3-473s21c1
Sequence:CCGGGCGGAACATCACTAGAATTAACTCGAGTTAATTCTAGTGATGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-191s21c1
Sequence:CCGGCCACAGCCTTATCTTCCGTAACTCGAGTTACGGAAGATAAGGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-3185s1c1
Sequence:CCGGCGGCATAGAGAAGCAAGTTAACTCGAGTTAACTTGCTTCTCTATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-1215s21c1
Sequence:CCGGCCCATCGACCAAGATTTCTATCTCGAGATAGAAATCTTGGTCGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-265s1c1
Sequence:CCGGCCAGCATCAGAATGGCATGTACTCGAGTACATGCCATTCTGATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-184s1c1
Sequence:CCGGCCACAGCCTTATCTTCCGTAACTCGAGTTACGGAAGATAAGGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018822.2-1208s1c1
Sequence:CCGGCCCATCGACCAAGATTTCTATCTCGAGATAGAAATCTTGGTCGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-1600s21c1
Sequence:CCGGACAGCTGCACCTTCTACATACCTCGAGGTATGTAGAAGGTGCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018822
VALIDATED
SGSH MISSION shRNA shRNA Plasmid DNA
N-sulfoglucosamine sulfohydrolase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018822.3-473s21c1
Sequence:CCGGGCGGAACATCACTAGAATTAACTCGAGTTAATTCTAGTGATGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-191s21c1
Sequence:CCGGCCACAGCCTTATCTTCCGTAACTCGAGTTACGGAAGATAAGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-3185s1c1
Sequence:CCGGCGGCATAGAGAAGCAAGTTAACTCGAGTTAACTTGCTTCTCTATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-1215s21c1
Sequence:CCGGCCCATCGACCAAGATTTCTATCTCGAGATAGAAATCTTGGTCGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-265s1c1
Sequence:CCGGCCAGCATCAGAATGGCATGTACTCGAGTACATGCCATTCTGATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-184s1c1
Sequence:CCGGCCACAGCCTTATCTTCCGTAACTCGAGTTACGGAAGATAAGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018822.2-1208s1c1
Sequence:CCGGCCCATCGACCAAGATTTCTATCTCGAGATAGAAATCTTGGTCGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-1600s21c1
Sequence:CCGGACAGCTGCACCTTCTACATACCTCGAGGTATGTAGAAGGTGCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018822
VALIDATED
SGSH MISSION shRNA Lentiviral Transduction Particles
N-sulfoglucosamine sulfohydrolase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018822.3-473s21c1
Sequence:CCGGGCGGAACATCACTAGAATTAACTCGAGTTAATTCTAGTGATGTTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-191s21c1
Sequence:CCGGCCACAGCCTTATCTTCCGTAACTCGAGTTACGGAAGATAAGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-3185s1c1
Sequence:CCGGCGGCATAGAGAAGCAAGTTAACTCGAGTTAACTTGCTTCTCTATGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-1215s21c1
Sequence:CCGGCCCATCGACCAAGATTTCTATCTCGAGATAGAAATCTTGGTCGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-265s1c1
Sequence:CCGGCCAGCATCAGAATGGCATGTACTCGAGTACATGCCATTCTGATGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018822.2-184s1c1
Sequence:CCGGCCACAGCCTTATCTTCCGTAACTCGAGTTACGGAAGATAAGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018822.2-1208s1c1
Sequence:CCGGCCCATCGACCAAGATTTCTATCTCGAGATAGAAATCTTGGTCGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018822.3-1600s21c1
Sequence:CCGGACAGCTGCACCTTCTACATACCTCGAGGTATGTAGAAGGTGCAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)