EMAIL THIS PAGE TO A FRIEND

SGSM1

small G protein signaling modulator 1

87 Gene Product Result for
Synonyms: RUTBC2
Gene ID:
Mouse(52850) small G protein signaling modulator 1
Rat(288743) small G protein signaling modulator 1
cow(515653) small G protein signaling modulator 1
sheep(101116605) small G protein signaling modulator 1
domestic guinea pig(100729684) small G protein signaling modulator 1
naked mole-rat(101711753) small G protein signaling modulator 1
Domestic Rabbit(100350208) small G protein signaling modulator 1
Zebrafish(100270734) small G protein signaling modulator 1
dog(486324) small G protein signaling modulator 1
Horse(100065654) small G protein signaling modulator 1
chicken(430664) small G protein signaling modulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039948 Rosetta Predictions human pricing
NM_001098497 Rosetta Predictions human pricing
NM_001098498 Rosetta Predictions human pricing
NM_133454 Rosetta Predictions human pricing
NM_001105937 Rosetta Predictions rat pricing
NM_172718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016496 predicted 3052
2 SASI_Hs01_00016498 predicted 3286
3 SASI_Hs01_00016500 predicted 1853
4 SASI_Hs01_00016504 predicted 1076
5 SASI_Hs02_00308726 predicted 3048
6 SASI_Hs01_00016505 predicted 712
7 SASI_Hs02_00308727 predicted 523
8 SASI_Hs02_00308728 predicted 3520
9 SASI_Hs02_00308729 predicted 523
10 SASI_Hs02_00308730 predicted 368
11 SASI_Hs01_00016497 predicted 1658
12 SASI_Hs01_00016499 predicted 1281
13 SASI_Hs01_00016501 predicted 583
14 SASI_Hs01_00016502 predicted 1267
15 SASI_Hs01_00016503 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319057 predicted 2887
2 SASI_Hs02_00319058 predicted 3122
3 SASI_Hs02_00319059 predicted 1683
4 SASI_Hs02_00319060 predicted 1079
5 SASI_Hs02_00319061 predicted 2889
6 SASI_Hs02_00319062 predicted 715
7 SASI_Hs02_00319063 predicted 523
8 SASI_Hs02_00319064 predicted 3357
9 SASI_Hs02_00319065 predicted 524
10 SASI_Hs02_00319066 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319067 predicted 2703
2 SASI_Hs02_00319068 predicted 2938
3 SASI_Hs02_00319069 predicted 1689
4 SASI_Hs02_00319070 predicted 1079
5 SASI_Hs02_00319071 predicted 2700
6 SASI_Hs02_00319072 predicted 711
7 SASI_Hs02_00319073 predicted 527
8 SASI_Hs02_00319074 predicted 3176
9 SASI_Hs02_00319075 predicted 525
10 SASI_Hs02_00319076 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151749 predicted 2865
2 SASI_Hs01_00151751 predicted 3100
3 SASI_Hs01_00151753 predicted 1849
4 SASI_Hs01_00151757 predicted 1082
5 SASI_Hs02_00363137 predicted 2866
6 SASI_Hs01_00151758 predicted 719
7 SASI_Hs02_00363138 predicted 521
8 SASI_Hs02_00363139 predicted 3335
9 SASI_Hs02_00363140 predicted 527
10 SASI_Hs02_00363141 predicted 373
11 SASI_Hs01_00151750 predicted 1657
12 SASI_Hs01_00151752 predicted 1286
13 SASI_Hs01_00151754 predicted 587
14 SASI_Hs01_00151755 predicted 1266
15 SASI_Hs01_00151756 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214012 predicted 1284
2 SASI_Rn02_00214013 predicted 2698
3 SASI_Rn02_00214014 predicted 941
4 SASI_Rn02_00214015 predicted 1744
5 SASI_Rn02_00214016 predicted 430
6 SASI_Rn02_00214017 predicted 695
7 SASI_Rn02_00214018 predicted 1056
8 SASI_Rn02_00214019 predicted 1153
9 SASI_Rn02_00214020 predicted 2313
10 SASI_Rn02_00214021 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120280 predicted 1319
2 SASI_Mm01_00120281 predicted 3274
3 SASI_Mm01_00120282 predicted 3080
4 SASI_Mm01_00120283 predicted 2990
5 SASI_Mm01_00120284 predicted 978
6 SASI_Mm01_00120285 predicted 2741
7 SASI_Mm01_00120286 predicted 1850
8 SASI_Mm01_00120287 predicted 882
9 SASI_Mm01_00120288 predicted 796
10 SASI_Mm01_00120289 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039948
SGSM1 MISSION shRNA Bacterial Glycerol Stock
small G protein signaling modulator 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-3339s21c1
Sequence:CCGGTCAAGCGAGAACTCGTCTATGCTCGAGCATAGACGAGTTCTCGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-1389s21c1
Sequence:CCGGATGATGAGGCCACGGATTATGCTCGAGCATAATCCGTGGCCTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-360s21c1
Sequence:CCGGATAAGATTGCAGCCCTCTTTACTCGAGTAAAGAGGGCTGCAATCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-1949s21c1
Sequence:CCGGCTTCACGACAGCACAAGTTACCTCGAGGTAACTTGTGCTGTCGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039948.2-4085s21c1
Sequence:CCGGTGACCCTCCACCTCGACATTACTCGAGTAATGTCGAGGTGGAGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039948
SGSM1 MISSION shRNA shRNA Plasmid DNA
small G protein signaling modulator 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-3339s21c1
Sequence:CCGGTCAAGCGAGAACTCGTCTATGCTCGAGCATAGACGAGTTCTCGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-1389s21c1
Sequence:CCGGATGATGAGGCCACGGATTATGCTCGAGCATAATCCGTGGCCTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-360s21c1
Sequence:CCGGATAAGATTGCAGCCCTCTTTACTCGAGTAAAGAGGGCTGCAATCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-1949s21c1
Sequence:CCGGCTTCACGACAGCACAAGTTACCTCGAGGTAACTTGTGCTGTCGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039948.2-4085s21c1
Sequence:CCGGTGACCCTCCACCTCGACATTACTCGAGTAATGTCGAGGTGGAGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039948
SGSM1 MISSION shRNA Lentiviral Transduction Particles
small G protein signaling modulator 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-3339s21c1
Sequence:CCGGTCAAGCGAGAACTCGTCTATGCTCGAGCATAGACGAGTTCTCGCTTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-1389s21c1
Sequence:CCGGATGATGAGGCCACGGATTATGCTCGAGCATAATCCGTGGCCTCATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-360s21c1
Sequence:CCGGATAAGATTGCAGCCCTCTTTACTCGAGTAAAGAGGGCTGCAATCTTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039948.2-1949s21c1
Sequence:CCGGCTTCACGACAGCACAAGTTACCTCGAGGTAACTTGTGCTGTCGTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039948.2-4085s21c1
Sequence:CCGGTGACCCTCCACCTCGACATTACTCGAGTAATGTCGAGGTGGAGGGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172718
SGSM1 MISSION shRNA Bacterial Glycerol Stock
small G protein signaling modulator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172718.1-4904s1c1
Sequence:CCGGGCCTCCTATTTATTCCATTTACTCGAGTAAATGGAATAAATAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-2761s1c1
Sequence:CCGGCAGCTATATCTGGCAGCACATCTCGAGATGTGCTGCCAGATATAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-99s1c1
Sequence:CCGGAGATCATGGAAGAAGCCGTTACTCGAGTAACGGCTTCTTCCATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-1463s1c1
Sequence:CCGGCCACTGAAACTGCTGTGTGATCTCGAGATCACACAGCAGTTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-3286s1c1
Sequence:CCGGGCAGATTCTAATTGAGAACAACTCGAGTTGTTCTCAATTAGAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172718
SGSM1 MISSION shRNA shRNA Plasmid DNA
small G protein signaling modulator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172718.1-4904s1c1
Sequence:CCGGGCCTCCTATTTATTCCATTTACTCGAGTAAATGGAATAAATAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-2761s1c1
Sequence:CCGGCAGCTATATCTGGCAGCACATCTCGAGATGTGCTGCCAGATATAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-99s1c1
Sequence:CCGGAGATCATGGAAGAAGCCGTTACTCGAGTAACGGCTTCTTCCATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-1463s1c1
Sequence:CCGGCCACTGAAACTGCTGTGTGATCTCGAGATCACACAGCAGTTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-3286s1c1
Sequence:CCGGGCAGATTCTAATTGAGAACAACTCGAGTTGTTCTCAATTAGAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172718
SGSM1 MISSION shRNA Lentiviral Transduction Particles
small G protein signaling modulator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172718.1-4904s1c1
Sequence:CCGGGCCTCCTATTTATTCCATTTACTCGAGTAAATGGAATAAATAGGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-2761s1c1
Sequence:CCGGCAGCTATATCTGGCAGCACATCTCGAGATGTGCTGCCAGATATAGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-99s1c1
Sequence:CCGGAGATCATGGAAGAAGCCGTTACTCGAGTAACGGCTTCTTCCATGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-1463s1c1
Sequence:CCGGCCACTGAAACTGCTGTGTGATCTCGAGATCACACAGCAGTTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172718.1-3286s1c1
Sequence:CCGGGCAGATTCTAATTGAGAACAACTCGAGTTGTTCTCAATTAGAATCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)