EMAIL THIS PAGE TO A FRIEND

SGSM2

small G protein signaling modulator 2

146 Gene Product Result for
Synonyms: RUTBC1
UniProtKB ID: O43147, A5LGW2, B4DH69, Q49AC2, Q6ZUY2, Q8IXU4
Gene ID:
Mouse(97761) small G protein signaling modulator 2
Rat(303304) small G protein signaling modulator 2
chicken(417673) small G protein signaling modulator 2
dog(480654) small G protein signaling modulator 2
Horse(100072485) small G protein signaling modulator 2
domestic cat(101083305) small G protein signaling modulator 2
Domestic Rabbit(100354888) small G protein signaling modulator 2
naked mole-rat(101705586) small G protein signaling modulator 2
domestic guinea pig(100714849) small G protein signaling modulator 2
cow(539734) small G protein signaling modulator 2
sheep(101104766) small G protein signaling modulator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098509 Rosetta Predictions human pricing
NM_014853 Rosetta Predictions human pricing
NM_001107020 Rosetta Predictions rat pricing
NM_197943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319157 predicted 2543
2 SASI_Hs02_00319158 predicted 3096
3 SASI_Hs02_00319159 predicted 2938
4 SASI_Hs02_00319160 predicted 2132
5 SASI_Hs02_00319161 predicted 2178
6 SASI_Hs02_00319162 predicted 2990
7 SASI_Hs02_00319163 predicted 2541
8 SASI_Hs02_00319164 predicted 2539
9 SASI_Hs02_00319165 predicted 548
10 SASI_Hs02_00319166 predicted 2629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116672 predicted 2676
2 SASI_Hs02_00346419 predicted 3234
3 SASI_Hs01_00116671 predicted 3075
4 SASI_Hs01_00116673 predicted 2266
5 SASI_Hs02_00346420 predicted 2314
6 SASI_Hs02_00346421 predicted 3123
7 SASI_Hs02_00346422 predicted 2682
8 SASI_Hs02_00346423 predicted 2679
9 SASI_Hs01_00116676 predicted 544
10 SASI_Hs01_00116679 predicted 2769
11 SASI_Hs01_00116674 predicted 369
12 SASI_Hs01_00116675 predicted 1415
13 SASI_Hs01_00116677 predicted 1368
14 SASI_Hs01_00116678 predicted 3081
15 SASI_Hs01_00116680 predicted 3075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224696 predicted 2553
2 SASI_Rn02_00224697 predicted 2151
3 SASI_Rn02_00224698 predicted 2557
4 SASI_Rn02_00224699 predicted 2140
5 SASI_Rn02_00224700 predicted 2556
6 SASI_Rn02_00224701 predicted 593
7 SASI_Rn02_00224702 predicted 2273
8 SASI_Rn02_00224703 predicted 557
9 SASI_Rn02_00224704 predicted 866
10 SASI_Rn02_00224705 predicted 3073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022486 predicted 2558
2 SASI_Mm01_00022487 predicted 1747
3 SASI_Mm02_00350653 predicted 1822
4 SASI_Mm01_00022488 predicted 612
5 SASI_Mm01_00022489 predicted 569
6 SASI_Mm01_00022491 predicted 1461
7 SASI_Mm01_00022492 predicted 597
8 SASI_Mm01_00022493 predicted 921
9 SASI_Mm01_00022494 predicted 1667
10 SASI_Mm01_00022495 predicted 2328
11 SASI_Mm01_00022490 predicted 2874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014853
VALIDATED
SGSM2 MISSION shRNA Bacterial Glycerol Stock
small G protein signaling modulator 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-1372s21c1
Sequence:CCGGAGCATTCGCTCCGTGGATATGCTCGAGCATATCCACGGAGCGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014853.1-1992s1c1
Sequence:CCGGGCAAGTTTACTACGGAGGCATCTCGAGATGCCTCCGTAGTAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014853.1-4059s1c1
Sequence:CCGGCCTTGCGTTCTGCATTAGGTACTCGAGTACCTAATGCAGAACGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014853.2-3431s21c1
Sequence:CCGGCCACCTCTGTTCCTAACAAAGCTCGAGCTTTGTTAGGAACAGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-2430s21c1
Sequence:CCGGACTGCCCTCCTCTCGCAATTACTCGAGTAATTGCGAGAGGAGGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014853.1-1458s1c1
Sequence:CCGGCGAGCACATCACTATTAACTACTCGAGTAGTTAATAGTGATGTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-2644s21c1
Sequence:CCGGTGTGCGGCTGCCTACACTATACTCGAGTATAGTGTAGGCAGCCGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014853.1-3130s1c1
Sequence:CCGGCACATCTCATCGGAGCACTTTCTCGAGAAAGTGCTCCGATGAGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014853
VALIDATED
SGSM2 MISSION shRNA shRNA Plasmid DNA
small G protein signaling modulator 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-1372s21c1
Sequence:CCGGAGCATTCGCTCCGTGGATATGCTCGAGCATATCCACGGAGCGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014853.1-1992s1c1
Sequence:CCGGGCAAGTTTACTACGGAGGCATCTCGAGATGCCTCCGTAGTAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014853.1-4059s1c1
Sequence:CCGGCCTTGCGTTCTGCATTAGGTACTCGAGTACCTAATGCAGAACGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014853.2-3431s21c1
Sequence:CCGGCCACCTCTGTTCCTAACAAAGCTCGAGCTTTGTTAGGAACAGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-2430s21c1
Sequence:CCGGACTGCCCTCCTCTCGCAATTACTCGAGTAATTGCGAGAGGAGGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014853.1-1458s1c1
Sequence:CCGGCGAGCACATCACTATTAACTACTCGAGTAGTTAATAGTGATGTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-2644s21c1
Sequence:CCGGTGTGCGGCTGCCTACACTATACTCGAGTATAGTGTAGGCAGCCGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014853.1-3130s1c1
Sequence:CCGGCACATCTCATCGGAGCACTTTCTCGAGAAAGTGCTCCGATGAGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014853
VALIDATED
SGSM2 MISSION shRNA Lentiviral Transduction Particles
small G protein signaling modulator 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-1372s21c1
Sequence:CCGGAGCATTCGCTCCGTGGATATGCTCGAGCATATCCACGGAGCGAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014853.1-1992s1c1
Sequence:CCGGGCAAGTTTACTACGGAGGCATCTCGAGATGCCTCCGTAGTAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155607    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014853.1-4059s1c1
Sequence:CCGGCCTTGCGTTCTGCATTAGGTACTCGAGTACCTAATGCAGAACGCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014853.2-3431s21c1
Sequence:CCGGCCACCTCTGTTCCTAACAAAGCTCGAGCTTTGTTAGGAACAGAGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-2430s21c1
Sequence:CCGGACTGCCCTCCTCTCGCAATTACTCGAGTAATTGCGAGAGGAGGGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014853.1-1458s1c1
Sequence:CCGGCGAGCACATCACTATTAACTACTCGAGTAGTTAATAGTGATGTGCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014853.2-2644s21c1
Sequence:CCGGTGTGCGGCTGCCTACACTATACTCGAGTATAGTGTAGGCAGCCGCACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014853.1-3130s1c1
Sequence:CCGGCACATCTCATCGGAGCACTTTCTCGAGAAAGTGCTCCGATGAGATGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197943
VALIDATED
SGSM2 MISSION shRNA Bacterial Glycerol Stock
small G protein signaling modulator 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197943.1-2558s1c1
Sequence:CCGGGCCTTAAATCTGCACCGCATACTCGAGTATGCGGTGCAGATTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-2525s1c1
Sequence:CCGGGCAGCCTATACTATAGAATTACTCGAGTAATTCTATAGTATAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197943.1-289s1c1
Sequence:CCGGGCATGAAGATAGCAGCCACATCTCGAGATGTGGCTGCTATCTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-3072s1c1
Sequence:CCGGCCGTGACAACAACATGGACTTCTCGAGAAGTCCATGTTGTTGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-3509s1c1
Sequence:CCGGCCTCTCAAACAACTTAGAATACTCGAGTATTCTAAGTTGTTTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197943
VALIDATED
SGSM2 MISSION shRNA shRNA Plasmid DNA
small G protein signaling modulator 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197943.1-2558s1c1
Sequence:CCGGGCCTTAAATCTGCACCGCATACTCGAGTATGCGGTGCAGATTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-2525s1c1
Sequence:CCGGGCAGCCTATACTATAGAATTACTCGAGTAATTCTATAGTATAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197943.1-289s1c1
Sequence:CCGGGCATGAAGATAGCAGCCACATCTCGAGATGTGGCTGCTATCTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-3072s1c1
Sequence:CCGGCCGTGACAACAACATGGACTTCTCGAGAAGTCCATGTTGTTGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-3509s1c1
Sequence:CCGGCCTCTCAAACAACTTAGAATACTCGAGTATTCTAAGTTGTTTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197943
VALIDATED
SGSM2 MISSION shRNA Lentiviral Transduction Particles
small G protein signaling modulator 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197943.1-2558s1c1
Sequence:CCGGGCCTTAAATCTGCACCGCATACTCGAGTATGCGGTGCAGATTTAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-2525s1c1
Sequence:CCGGGCAGCCTATACTATAGAATTACTCGAGTAATTCTATAGTATAGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197943.1-289s1c1
Sequence:CCGGGCATGAAGATAGCAGCCACATCTCGAGATGTGGCTGCTATCTTCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-3072s1c1
Sequence:CCGGCCGTGACAACAACATGGACTTCTCGAGAAGTCCATGTTGTTGTCACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197943.1-3509s1c1
Sequence:CCGGCCTCTCAAACAACTTAGAATACTCGAGTATTCTAAGTTGTTTGAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)