EMAIL THIS PAGE TO A FRIEND

SGSM3

small G protein signaling modulator 3

45 Gene Product Result for
Synonyms: MAP RABGAP5 RUSC3 RUTBC3 RabGAP-5
UniProtKB ID: Q96HU1, B0QY79, Q7Z709, Q9NT69
Gene ID:
Mouse(105835) small G protein signaling modulator 3
Rat(362963) small G protein signaling modulator 3
cow(767820) small G protein signaling modulator 3
sheep(101102385) small G protein signaling modulator 3
domestic guinea pig(100713374) small G protein signaling modulator 3
naked mole-rat(101715783) small G protein signaling modulator 3
Domestic Rabbit(100359249) small G protein signaling modulator 3
Zebrafish(406635) small G protein signaling modulator 3
domestic cat(101098310) small G protein signaling modulator 3
dog(481239) small G protein signaling modulator 3
chicken(418008) small G protein signaling modulator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015705 Rosetta Predictions human pricing
NM_198787 Rosetta Predictions rat pricing
NM_134091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086440 predicted 2007
2 SASI_Hs01_00086441 predicted 473
3 SASI_Hs01_00086442 predicted 1713
4 SASI_Hs02_00348379 predicted 321
5 SASI_Hs01_00086444 predicted 1908
6 SASI_Hs02_00348380 predicted 1458
7 SASI_Hs02_00348381 predicted 318
8 SASI_Hs02_00348382 predicted 274
9 SASI_Hs01_00086446 predicted 2301
10 SASI_Hs01_00086448 predicted 1797
11 SASI_Hs01_00086443 predicted 2014
12 SASI_Hs01_00086445 predicted 1012
13 SASI_Hs01_00086447 predicted 2664
14 SASI_Hs01_00086449 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270064 predicted 1913
2 SASI_Rn01_00086072 predicted 1364
3 SASI_Rn01_00086074 predicted 1577
4 SASI_Rn01_00086075 predicted 1963
5 SASI_Rn01_00086076 predicted 237
6 SASI_Rn01_00086077 predicted 2345
7 SASI_Rn01_00086078 predicted 915
8 SASI_Rn01_00086079 predicted 774
9 SASI_Rn01_00086080 predicted 2056
10 SASI_Rn02_00270065 predicted 419
11 SASI_Rn01_00086071 predicted 1628
12 SASI_Rn01_00086073 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086732 predicted 270
2 SASI_Mm01_00086733 predicted 1948
3 SASI_Mm01_00086734 predicted 1391
4 SASI_Mm01_00086735 predicted 1990
5 SASI_Mm01_00086736 predicted 1119
6 SASI_Mm01_00086737 predicted 1723
7 SASI_Mm01_00086738 predicted 810
8 SASI_Mm01_00086739 predicted 2385
9 SASI_Mm01_00086740 predicted 460
10 SASI_Mm02_00339316 predicted 552
11 SASI_Mm01_00086741 predicted 1278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134091
VALIDATED
SGSM3 MISSION shRNA Bacterial Glycerol Stock
small G protein signaling modulator 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134091.1-927s1c1
Sequence:CCGGGCCTCGCTTAGACAAACTGTTCTCGAGAACAGTTTGTCTAAGCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1273s1c1
Sequence:CCGGGCCTACCTTATTGCAGACCAACTCGAGTTGGTCTGCAATAAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1859s1c1
Sequence:CCGGCCCTGTTTGAACACGGATTGACTCGAGTCAATCCGTGTTCAAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-2439s1c1
Sequence:CCGGCCCATCATAGACTGCCTGGAACTCGAGTTCCAGGCAGTCTATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1980s1c1
Sequence:CCGGCCTGGTGCTCTGTAAGACATACTCGAGTATGTCTTACAGAGCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134091
VALIDATED
SGSM3 MISSION shRNA shRNA Plasmid DNA
small G protein signaling modulator 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134091.1-927s1c1
Sequence:CCGGGCCTCGCTTAGACAAACTGTTCTCGAGAACAGTTTGTCTAAGCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1273s1c1
Sequence:CCGGGCCTACCTTATTGCAGACCAACTCGAGTTGGTCTGCAATAAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1859s1c1
Sequence:CCGGCCCTGTTTGAACACGGATTGACTCGAGTCAATCCGTGTTCAAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-2439s1c1
Sequence:CCGGCCCATCATAGACTGCCTGGAACTCGAGTTCCAGGCAGTCTATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1980s1c1
Sequence:CCGGCCTGGTGCTCTGTAAGACATACTCGAGTATGTCTTACAGAGCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134091
VALIDATED
SGSM3 MISSION shRNA Lentiviral Transduction Particles
small G protein signaling modulator 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134091.1-927s1c1
Sequence:CCGGGCCTCGCTTAGACAAACTGTTCTCGAGAACAGTTTGTCTAAGCGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1273s1c1
Sequence:CCGGGCCTACCTTATTGCAGACCAACTCGAGTTGGTCTGCAATAAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1859s1c1
Sequence:CCGGCCCTGTTTGAACACGGATTGACTCGAGTCAATCCGTGTTCAAACAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-2439s1c1
Sequence:CCGGCCCATCATAGACTGCCTGGAACTCGAGTTCCAGGCAGTCTATGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134091.1-1980s1c1
Sequence:CCGGCCTGGTGCTCTGTAAGACATACTCGAGTATGTCTTACAGAGCACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015705
VALIDATED
SGSM3 MISSION shRNA Bacterial Glycerol Stock
small G protein signaling modulator 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-1208s21c1
Sequence:CCGGCTTCAACACGCTATCGGATATCTCGAGATATCCGATAGCGTGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015705.4-2841s1c1
Sequence:CCGGCAGAGCTGTATTCAGGTCCAACTCGAGTTGGACCTGAATACAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1715s1c1
Sequence:CCGGCAAGAACGACATCATCACAATCTCGAGATTGTGATGATGTCGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-2014s21c1
Sequence:CCGGGAGACTTTGCCTCCGTGTATTCTCGAGAATACACGGAGGCAAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-2764s21c1
Sequence:CCGGCTGGCCTCTTTGGTTTATAAACTCGAGTTTATAAACCAAAGAGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-351s1c1
Sequence:CCGGCGTGTGTACAAGGAAGAAGGTCTCGAGACCTTCTTCCTTGTACACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-318s1c1
Sequence:CCGGCAACCAGAGTTCTACTACGATCTCGAGATCGTAGTAGAACTCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015705.4-2669s1c1
Sequence:CCGGCAAACCACAGTTTGTACCAAACTCGAGTTTGGTACAAACTGTGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-2147s1c1
Sequence:CCGGGCATGCACAAATGGATGTGAACTCGAGTTCACATCCATTTGTGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1727s1c1
Sequence:CCGGCATCACAATCGTGTCTCAGAACTCGAGTTCTGAGACACGATTGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015705.4-335s1c1
Sequence:CCGGCGATGAGTTTGGTTTCCGTGTCTCGAGACACGGAAACCAAACTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015705.4-642s1c1
Sequence:CCGGGTGAAGAACAGCTCCAACGATCTCGAGATCGTTGGAGCTGTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1919s1c1
Sequence:CCGGCCTGTTCGAACATGGACTGAACTCGAGTTCAGTCCATGTTCGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-1577s21c1
Sequence:CCGGGGAGCTGACTCCAGACTATAGCTCGAGCTATAGTCTGGAGTCAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015705.4-446s21c1
Sequence:CCGGCCACCTGGAGTTCACCCATAACTCGAGTTATGGGTGAACTCCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015705
VALIDATED
SGSM3 MISSION shRNA shRNA Plasmid DNA
small G protein signaling modulator 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-1208s21c1
Sequence:CCGGCTTCAACACGCTATCGGATATCTCGAGATATCCGATAGCGTGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015705.4-2841s1c1
Sequence:CCGGCAGAGCTGTATTCAGGTCCAACTCGAGTTGGACCTGAATACAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1715s1c1
Sequence:CCGGCAAGAACGACATCATCACAATCTCGAGATTGTGATGATGTCGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-2014s21c1
Sequence:CCGGGAGACTTTGCCTCCGTGTATTCTCGAGAATACACGGAGGCAAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-2764s21c1
Sequence:CCGGCTGGCCTCTTTGGTTTATAAACTCGAGTTTATAAACCAAAGAGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-351s1c1
Sequence:CCGGCGTGTGTACAAGGAAGAAGGTCTCGAGACCTTCTTCCTTGTACACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-318s1c1
Sequence:CCGGCAACCAGAGTTCTACTACGATCTCGAGATCGTAGTAGAACTCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015705.4-2669s1c1
Sequence:CCGGCAAACCACAGTTTGTACCAAACTCGAGTTTGGTACAAACTGTGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-2147s1c1
Sequence:CCGGGCATGCACAAATGGATGTGAACTCGAGTTCACATCCATTTGTGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1727s1c1
Sequence:CCGGCATCACAATCGTGTCTCAGAACTCGAGTTCTGAGACACGATTGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015705.4-335s1c1
Sequence:CCGGCGATGAGTTTGGTTTCCGTGTCTCGAGACACGGAAACCAAACTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015705.4-642s1c1
Sequence:CCGGGTGAAGAACAGCTCCAACGATCTCGAGATCGTTGGAGCTGTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1919s1c1
Sequence:CCGGCCTGTTCGAACATGGACTGAACTCGAGTTCAGTCCATGTTCGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-1577s21c1
Sequence:CCGGGGAGCTGACTCCAGACTATAGCTCGAGCTATAGTCTGGAGTCAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015705.4-446s21c1
Sequence:CCGGCCACCTGGAGTTCACCCATAACTCGAGTTATGGGTGAACTCCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015705
VALIDATED
SGSM3 MISSION shRNA Lentiviral Transduction Particles
small G protein signaling modulator 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-1208s21c1
Sequence:CCGGCTTCAACACGCTATCGGATATCTCGAGATATCCGATAGCGTGTTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015705.4-2841s1c1
Sequence:CCGGCAGAGCTGTATTCAGGTCCAACTCGAGTTGGACCTGAATACAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1715s1c1
Sequence:CCGGCAAGAACGACATCATCACAATCTCGAGATTGTGATGATGTCGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-2014s21c1
Sequence:CCGGGAGACTTTGCCTCCGTGTATTCTCGAGAATACACGGAGGCAAAGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-2764s21c1
Sequence:CCGGCTGGCCTCTTTGGTTTATAAACTCGAGTTTATAAACCAAAGAGGCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-351s1c1
Sequence:CCGGCGTGTGTACAAGGAAGAAGGTCTCGAGACCTTCTTCCTTGTACACACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-318s1c1
Sequence:CCGGCAACCAGAGTTCTACTACGATCTCGAGATCGTAGTAGAACTCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015705.4-2669s1c1
Sequence:CCGGCAAACCACAGTTTGTACCAAACTCGAGTTTGGTACAAACTGTGGTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-2147s1c1
Sequence:CCGGGCATGCACAAATGGATGTGAACTCGAGTTCACATCCATTTGTGCATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1727s1c1
Sequence:CCGGCATCACAATCGTGTCTCAGAACTCGAGTTCTGAGACACGATTGTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015705.4-335s1c1
Sequence:CCGGCGATGAGTTTGGTTTCCGTGTCTCGAGACACGGAAACCAAACTCATCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015705.4-642s1c1
Sequence:CCGGGTGAAGAACAGCTCCAACGATCTCGAGATCGTTGGAGCTGTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015705.4-1919s1c1
Sequence:CCGGCCTGTTCGAACATGGACTGAACTCGAGTTCAGTCCATGTTCGAACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015705.4-1577s21c1
Sequence:CCGGGGAGCTGACTCCAGACTATAGCTCGAGCTATAGTCTGGAGTCAGCTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015705.4-446s21c1
Sequence:CCGGCCACCTGGAGTTCACCCATAACTCGAGTTATGGGTGAACTCCAGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)