EMAIL THIS PAGE TO A FRIEND

SGTA

small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha

48 Gene Product Result for
Synonyms: SGT alphaSGT hSGT
UniProtKB ID: O43765, D6W610, Q6FIA9, Q9BTZ9
Gene ID:
Human(6449) Summary: This gene encodes a protein which is capable of interacting with the major nonstructural protein of parvovirus H-1 and 70-kDa heat shock cognate protein; however, its function is not known. Since this transcript is expressed ubiquitously in various tissues, this protein may serve a housekeeping function. [provided by RefSeq, Jul 2008]
Mouse(52551) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Rat(64667) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Zebrafish(431772) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
chicken(426396) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
dog(485067) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
domestic cat(101082292) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
naked mole-rat(101712587) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
domestic guinea pig(100731604) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
cow(504701) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
sheep(101119816) small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003021 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003021 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003021 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003021 Rosetta Predictions human pricing
NM_022703 Rosetta Predictions rat pricing
NM_024499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057073 predicted 838
2 SASI_Hs01_00057074 predicted 838
3 SASI_Hs01_00057075 predicted 305
4 SASI_Hs01_00057076 predicted 547
5 SASI_Hs01_00057077 predicted 442
6 SASI_Hs01_00057079 predicted 724
7 SASI_Hs01_00057080 predicted 1006
8 SASI_Hs01_00057081 predicted 844
9 SASI_Hs01_00057082 predicted 523
10 SASI_Hs02_00334918 predicted 235
11 SASI_Hs01_00057078 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263509 predicted 803
2 SASI_Rn02_00263510 predicted 382
3 SASI_Rn02_00263511 predicted 431
4 SASI_Rn02_00263512 predicted 636
5 SASI_Rn01_00105079 predicted 389
6 SASI_Rn01_00105080 predicted 759
7 SASI_Rn02_00263513 predicted 356
8 SASI_Rn01_00105082 predicted 988
9 SASI_Rn01_00105084 predicted 627
10 SASI_Rn02_00263514 predicted 743
11 SASI_Rn01_00105078 predicted 1205
12 SASI_Rn01_00105081 predicted 1188
13 SASI_Rn01_00105083 predicted 1098
14 SASI_Rn01_00105085 predicted 671
15 SASI_Rn01_00105086 predicted 360
16 SASI_Rn01_00105087 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107751 predicted 637
2 SASI_Mm01_00107752 predicted 625
3 SASI_Mm01_00107753 predicted 1330
4 SASI_Mm01_00107754 predicted 662
5 SASI_Mm01_00107755 predicted 387
6 SASI_Mm01_00107757 predicted 759
7 SASI_Mm02_00327873 predicted 1083
8 SASI_Mm01_00107758 predicted 994
9 SASI_Mm01_00107759 predicted 1272
10 SASI_Mm01_00107760 predicted 571
11 SASI_Mm01_00107756 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024499
VALIDATED
SGTA MISSION shRNA Bacterial Glycerol Stock
small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024499.1-1692s21c1
Sequence:CCGGGCCACCAGAACCATCTTTGTTCTCGAGAACAAAGATGGTTCTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1323s1c1
Sequence:CCGGCCTCCTAAAGGGACTTGAGTACTCGAGTACTCAAGTCCCTTTAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-633s1c1
Sequence:CCGGCCCTGACAACGACACATACAACTCGAGTTGTATGTGTCGTTGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1536s1c1
Sequence:CCGGCCATCAGCCAATCCTAACTTTCTCGAGAAAGTTAGGATTGGCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024499.1-439s21c1
Sequence:CCGGGCTGTCTACTTCTGTAACAGACTCGAGTCTGTTACAGAAGTAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024499.1-1536s21c1
Sequence:CCGGCCATCAGCCAATCCTAACTTTCTCGAGAAAGTTAGGATTGGCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024499.1-633s21c1
Sequence:CCGGCCCTGACAACGACACATACAACTCGAGTTGTATGTGTCGTTGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-439s1c1
Sequence:CCGGGCTGTCTACTTCTGTAACAGACTCGAGTCTGTTACAGAAGTAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1692s1c1
Sequence:CCGGGCCACCAGAACCATCTTTGTTCTCGAGAACAAAGATGGTTCTGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024499
VALIDATED
SGTA MISSION shRNA shRNA Plasmid DNA
small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024499.1-1692s21c1
Sequence:CCGGGCCACCAGAACCATCTTTGTTCTCGAGAACAAAGATGGTTCTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1323s1c1
Sequence:CCGGCCTCCTAAAGGGACTTGAGTACTCGAGTACTCAAGTCCCTTTAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-633s1c1
Sequence:CCGGCCCTGACAACGACACATACAACTCGAGTTGTATGTGTCGTTGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1536s1c1
Sequence:CCGGCCATCAGCCAATCCTAACTTTCTCGAGAAAGTTAGGATTGGCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024499.1-439s21c1
Sequence:CCGGGCTGTCTACTTCTGTAACAGACTCGAGTCTGTTACAGAAGTAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024499.1-1536s21c1
Sequence:CCGGCCATCAGCCAATCCTAACTTTCTCGAGAAAGTTAGGATTGGCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024499.1-633s21c1
Sequence:CCGGCCCTGACAACGACACATACAACTCGAGTTGTATGTGTCGTTGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-439s1c1
Sequence:CCGGGCTGTCTACTTCTGTAACAGACTCGAGTCTGTTACAGAAGTAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1692s1c1
Sequence:CCGGGCCACCAGAACCATCTTTGTTCTCGAGAACAAAGATGGTTCTGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024499
VALIDATED
SGTA MISSION shRNA Lentiviral Transduction Particles
small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024499.1-1692s21c1
Sequence:CCGGGCCACCAGAACCATCTTTGTTCTCGAGAACAAAGATGGTTCTGGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1323s1c1
Sequence:CCGGCCTCCTAAAGGGACTTGAGTACTCGAGTACTCAAGTCCCTTTAGGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-633s1c1
Sequence:CCGGCCCTGACAACGACACATACAACTCGAGTTGTATGTGTCGTTGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1536s1c1
Sequence:CCGGCCATCAGCCAATCCTAACTTTCTCGAGAAAGTTAGGATTGGCTGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024499.1-439s21c1
Sequence:CCGGGCTGTCTACTTCTGTAACAGACTCGAGTCTGTTACAGAAGTAGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024499.1-1536s21c1
Sequence:CCGGCCATCAGCCAATCCTAACTTTCTCGAGAAAGTTAGGATTGGCTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024499.1-633s21c1
Sequence:CCGGCCCTGACAACGACACATACAACTCGAGTTGTATGTGTCGTTGTCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-439s1c1
Sequence:CCGGGCTGTCTACTTCTGTAACAGACTCGAGTCTGTTACAGAAGTAGACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024499.1-1692s1c1
Sequence:CCGGGCCACCAGAACCATCTTTGTTCTCGAGAACAAAGATGGTTCTGGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003021
VALIDATED
SGTA MISSION shRNA Bacterial Glycerol Stock
small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003021.3-2184s21c1
Sequence:CCGGCGTGTATCGTAGGTAGCAGTACTCGAGTACTGCTACCTACGATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-465s21c1
Sequence:CCGGCTTTGAAGCTGCCGTGCATTTCTCGAGAAATGCACGGCAGCTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003021.3-847s21c1
Sequence:CCGGGCTTCGAACCTAATGAACAATCTCGAGATTGTTCATTAGGTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-1004s21c1
Sequence:CCGGAGCAGAACCCAGAGTTGATAGCTCGAGCTATCAACTCTGGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-310s21c1
Sequence:CCGGCCTCAGACTCTGCCGGAGATACTCGAGTATCTCCGGCAGAGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-2184s1c1
Sequence:CCGGCGTGTATCGTAGGTAGCAGTACTCGAGTACTGCTACCTACGATACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003021.3-435s1c1
Sequence:CCGGCGAAGGAAACGAGCAGATGAACTCGAGTTCATCTGCTCGTTTCCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-310s1c1
Sequence:CCGGCCTCAGACTCTGCCGGAGATACTCGAGTATCTCCGGCAGAGTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-520s1c1
Sequence:CCGGGCCGTCTATTTCTGCAACAGACTCGAGTCTGTTGCAGAAATAGACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-847s1c1
Sequence:CCGGGCTTCGAACCTAATGAACAATCTCGAGATTGTTCATTAGGTTCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003021
VALIDATED
SGTA MISSION shRNA shRNA Plasmid DNA
small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003021.3-2184s21c1
Sequence:CCGGCGTGTATCGTAGGTAGCAGTACTCGAGTACTGCTACCTACGATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-465s21c1
Sequence:CCGGCTTTGAAGCTGCCGTGCATTTCTCGAGAAATGCACGGCAGCTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003021.3-847s21c1
Sequence:CCGGGCTTCGAACCTAATGAACAATCTCGAGATTGTTCATTAGGTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-1004s21c1
Sequence:CCGGAGCAGAACCCAGAGTTGATAGCTCGAGCTATCAACTCTGGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-310s21c1
Sequence:CCGGCCTCAGACTCTGCCGGAGATACTCGAGTATCTCCGGCAGAGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-2184s1c1
Sequence:CCGGCGTGTATCGTAGGTAGCAGTACTCGAGTACTGCTACCTACGATACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003021.3-435s1c1
Sequence:CCGGCGAAGGAAACGAGCAGATGAACTCGAGTTCATCTGCTCGTTTCCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-310s1c1
Sequence:CCGGCCTCAGACTCTGCCGGAGATACTCGAGTATCTCCGGCAGAGTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-520s1c1
Sequence:CCGGGCCGTCTATTTCTGCAACAGACTCGAGTCTGTTGCAGAAATAGACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-847s1c1
Sequence:CCGGGCTTCGAACCTAATGAACAATCTCGAGATTGTTCATTAGGTTCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003021
VALIDATED
SGTA MISSION shRNA Lentiviral Transduction Particles
small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003021.3-2184s21c1
Sequence:CCGGCGTGTATCGTAGGTAGCAGTACTCGAGTACTGCTACCTACGATACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-465s21c1
Sequence:CCGGCTTTGAAGCTGCCGTGCATTTCTCGAGAAATGCACGGCAGCTTCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003021.3-847s21c1
Sequence:CCGGGCTTCGAACCTAATGAACAATCTCGAGATTGTTCATTAGGTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-1004s21c1
Sequence:CCGGAGCAGAACCCAGAGTTGATAGCTCGAGCTATCAACTCTGGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003021.3-310s21c1
Sequence:CCGGCCTCAGACTCTGCCGGAGATACTCGAGTATCTCCGGCAGAGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007191    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-2184s1c1
Sequence:CCGGCGTGTATCGTAGGTAGCAGTACTCGAGTACTGCTACCTACGATACACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003021.3-435s1c1
Sequence:CCGGCGAAGGAAACGAGCAGATGAACTCGAGTTCATCTGCTCGTTTCCTTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-310s1c1
Sequence:CCGGCCTCAGACTCTGCCGGAGATACTCGAGTATCTCCGGCAGAGTCTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-520s1c1
Sequence:CCGGGCCGTCTATTTCTGCAACAGACTCGAGTCTGTTGCAGAAATAGACGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003021.3-847s1c1
Sequence:CCGGGCTTCGAACCTAATGAACAATCTCGAGATTGTTCATTAGGTTCGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)