EMAIL THIS PAGE TO A FRIEND

SGTB

small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta

53 Gene Product Result for
Synonyms: SGT2
UniProtKB ID: Q96EQ0
Gene ID:
Mouse(218544) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Rat(294708) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
cow(540864) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
sheep(101102012) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
domestic guinea pig(100727439) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
naked mole-rat(101711261) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
chicken(427166) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
dog(478080) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
domestic cat(101082545) small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019072 Rosetta Predictions human pricing
NM_181629 Rosetta Predictions rat pricing
NM_144838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239762 predicted 845
2 SASI_Hs02_00352662 predicted 1066
3 SASI_Hs01_00239763 predicted 219
4 SASI_Hs01_00239764 predicted 1059
5 SASI_Hs01_00239766 predicted 608
6 SASI_Hs01_00239768 predicted 536
7 SASI_Hs01_00239769 predicted 608
8 SASI_Hs01_00239770 predicted 733
9 SASI_Hs01_00239771 predicted 775
10 SASI_Hs02_00352663 predicted 777
11 SASI_Hs01_00239765 predicted 246
12 SASI_Hs01_00239767 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030591 predicted 374
2 SASI_Rn01_00030592 predicted 526
3 SASI_Rn01_00030593 predicted 1054
4 SASI_Rn01_00030594 predicted 430
5 SASI_Rn01_00030595 predicted 490
6 SASI_Rn01_00030596 predicted 425
7 SASI_Rn01_00030597 predicted 253
8 SASI_Rn01_00030598 predicted 203
9 SASI_Rn01_00030599 predicted 490
10 SASI_Rn01_00030600 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084315 predicted 588
2 SASI_Mm01_00084316 predicted 608
3 SASI_Mm01_00084317 predicted 405
4 SASI_Mm01_00084318 predicted 1157
5 SASI_Mm01_00084319 predicted 832
6 SASI_Mm01_00084320 predicted 522
7 SASI_Mm01_00084321 predicted 755
8 SASI_Mm01_00084322 predicted 635
9 SASI_Mm01_00084323 predicted 618
10 SASI_Mm01_00084324 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019072
VALIDATED
SGTB MISSION shRNA Bacterial Glycerol Stock
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-1088s21c1
Sequence:CCGCCACATCCGGAGCAGATCATTCCTCGAGGAATGATCTGCTCCGGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-206s1c1
Sequence:CCGGGTTATTCGTTTCTTACGGGAACTCGAGTTCCCGTAAGAAACGAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-653s21c1
Sequence:CCGGGCAATAGCAATTGATTCAAAGCTCGAGCTTTGAATCAATTGCTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-829s1c1
Sequence:CCGGGATAAATAATCCAGCCTTCATCTCGAGATGAAGGCTGGATTATTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019072.1-686s1c1
Sequence:CCGGGAAGCAGTTACAAGTTATCAACTCGAGTTGATAACTTGTAACTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019072.1-491s1c1
Sequence:CCGGGATTGTTACACACAGGCAATACTCGAGTATTGCCTGTGTGTAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-826s1c1
Sequence:CCGGCTTGATAAATAATCCAGCCTTCTCGAGAAGGCTGGATTATTTATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-922s21c1
Sequence:CCGGCCCTCAAGTTCAACAGCTAATCTCGAGATTAGCTGTTGAACTTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-704s21c1
Sequence:CCGGGCCCTCACTGCCTTGAATAAACTCGAGTTTATTCAAGGCAGTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019072
VALIDATED
SGTB MISSION shRNA shRNA Plasmid DNA
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-1088s21c1
Sequence:CCGCCACATCCGGAGCAGATCATTCCTCGAGGAATGATCTGCTCCGGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-206s1c1
Sequence:CCGGGTTATTCGTTTCTTACGGGAACTCGAGTTCCCGTAAGAAACGAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-653s21c1
Sequence:CCGGGCAATAGCAATTGATTCAAAGCTCGAGCTTTGAATCAATTGCTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-829s1c1
Sequence:CCGGGATAAATAATCCAGCCTTCATCTCGAGATGAAGGCTGGATTATTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019072.1-686s1c1
Sequence:CCGGGAAGCAGTTACAAGTTATCAACTCGAGTTGATAACTTGTAACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019072.1-491s1c1
Sequence:CCGGGATTGTTACACACAGGCAATACTCGAGTATTGCCTGTGTGTAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-826s1c1
Sequence:CCGGCTTGATAAATAATCCAGCCTTCTCGAGAAGGCTGGATTATTTATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-922s21c1
Sequence:CCGGCCCTCAAGTTCAACAGCTAATCTCGAGATTAGCTGTTGAACTTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-704s21c1
Sequence:CCGGGCCCTCACTGCCTTGAATAAACTCGAGTTTATTCAAGGCAGTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019072
VALIDATED
SGTB MISSION shRNA Lentiviral Transduction Particles
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-1088s21c1
Sequence:CCGCCACATCCGGAGCAGATCATTCCTCGAGGAATGATCTGCTCCGGATGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-206s1c1
Sequence:CCGGGTTATTCGTTTCTTACGGGAACTCGAGTTCCCGTAAGAAACGAATAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-653s21c1
Sequence:CCGGGCAATAGCAATTGATTCAAAGCTCGAGCTTTGAATCAATTGCTATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-829s1c1
Sequence:CCGGGATAAATAATCCAGCCTTCATCTCGAGATGAAGGCTGGATTATTTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019072.1-686s1c1
Sequence:CCGGGAAGCAGTTACAAGTTATCAACTCGAGTTGATAACTTGTAACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019072.1-491s1c1
Sequence:CCGGGATTGTTACACACAGGCAATACTCGAGTATTGCCTGTGTGTAACAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019072.1-826s1c1
Sequence:CCGGCTTGATAAATAATCCAGCCTTCTCGAGAAGGCTGGATTATTTATCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-922s21c1
Sequence:CCGGCCCTCAAGTTCAACAGCTAATCTCGAGATTAGCTGTTGAACTTGAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019072.2-704s21c1
Sequence:CCGGGCCCTCACTGCCTTGAATAAACTCGAGTTTATTCAAGGCAGTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144838
VALIDATED
SGTB MISSION shRNA Bacterial Glycerol Stock
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144838.1-682s21c1
Sequence:CCGGTCGCCCTCACTGCCATGAATACTCGAGTATTCATGGCAGTGAGGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-383s1c1
Sequence:CCGGGTTCACAAACTCCGTCTGTAACTCGAGTTACAGACGGAGTTTGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-543s1c1
Sequence:CCGGGATCCCAACAATGCCGTTTATCTCGAGATAAACGGCATTGTTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-231s1c1
Sequence:CCGGGTTATTCGTTTCTTGCGGGAACTCGAGTTCCCGCAAGAAACGAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144838.1-1928s21c1
Sequence:CCGGCGACGACGACGATGACTATTTCTCGAGAAATAGTCATCGTCGTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144838.1-544s21c1
Sequence:CCGGATCCCAACAATGCCGTTTATTCTCGAGAATAAACGGCATTGTTGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144838.1-749s21c1
Sequence:CCGGTCCTGAGAATGATTCGTATAACTCGAGTTATACGAATCATTCTCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144838
VALIDATED
SGTB MISSION shRNA shRNA Plasmid DNA
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144838.1-682s21c1
Sequence:CCGGTCGCCCTCACTGCCATGAATACTCGAGTATTCATGGCAGTGAGGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-383s1c1
Sequence:CCGGGTTCACAAACTCCGTCTGTAACTCGAGTTACAGACGGAGTTTGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-543s1c1
Sequence:CCGGGATCCCAACAATGCCGTTTATCTCGAGATAAACGGCATTGTTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-231s1c1
Sequence:CCGGGTTATTCGTTTCTTGCGGGAACTCGAGTTCCCGCAAGAAACGAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144838.1-1928s21c1
Sequence:CCGGCGACGACGACGATGACTATTTCTCGAGAAATAGTCATCGTCGTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144838.1-544s21c1
Sequence:CCGGATCCCAACAATGCCGTTTATTCTCGAGAATAAACGGCATTGTTGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144838.1-749s21c1
Sequence:CCGGTCCTGAGAATGATTCGTATAACTCGAGTTATACGAATCATTCTCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144838
VALIDATED
SGTB MISSION shRNA Lentiviral Transduction Particles
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144838.1-682s21c1
Sequence:CCGGTCGCCCTCACTGCCATGAATACTCGAGTATTCATGGCAGTGAGGGCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-383s1c1
Sequence:CCGGGTTCACAAACTCCGTCTGTAACTCGAGTTACAGACGGAGTTTGTGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-543s1c1
Sequence:CCGGGATCCCAACAATGCCGTTTATCTCGAGATAAACGGCATTGTTGGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144838.1-231s1c1
Sequence:CCGGGTTATTCGTTTCTTGCGGGAACTCGAGTTCCCGCAAGAAACGAATAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144838.1-1928s21c1
Sequence:CCGGCGACGACGACGATGACTATTTCTCGAGAAATAGTCATCGTCGTCGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144838.1-544s21c1
Sequence:CCGGATCCCAACAATGCCGTTTATTCTCGAGAATAAACGGCATTGTTGGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_144838.1-749s21c1
Sequence:CCGGTCCTGAGAATGATTCGTATAACTCGAGTTATACGAATCATTCTCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)