EMAIL THIS PAGE TO A FRIEND

SH2B1

SH2B adaptor protein 1

107 Gene Product Result for
Synonyms: PSM SH2B
Gene ID:
Human(25970) Summary: This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Mouse(20399) SH2B adaptor protein 1
Rat(89817) SH2B adaptor protein 1
cow(506066) SH2B adaptor protein 1
sheep(101112187) SH2B adaptor protein 1
naked mole-rat(101715023) SH2B adaptor protein 1
domestic guinea pig(100726510) SH2B adaptor protein 1
Zebrafish(558152) SH2B adaptor protein 1
dog(612792) SH2B adaptor protein 1
domestic cat(101090917) SH2B adaptor protein 1
Horse(100064371) SH2B adaptor protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015503 Rosetta Predictions human pricing
NM_001048180 Rosetta Predictions rat pricing
NM_134456 Rosetta Predictions rat pricing
NM_001081459 Rosetta Predictions mouse pricing
NM_011363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186997 predicted 3117
2 SASI_Hs01_00186999 predicted 3868
3 SASI_Hs01_00187000 predicted 3750
4 SASI_Hs01_00187001 predicted 3137
5 SASI_Hs01_00187002 predicted 3370
6 SASI_Hs01_00187003 predicted 2757
7 SASI_Hs01_00187004 predicted 3871
8 SASI_Hs01_00187005 predicted 3136
9 SASI_Hs02_00347984 predicted 3197
10 SASI_Hs02_00347985 predicted 4215
11 SASI_Hs01_00186998 predicted 4219
12 SASI_Hs01_00187006 predicted 4075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207382 predicted 1356
2 SASI_Rn02_00207383 predicted 558
3 SASI_Rn02_00207384 predicted 305
4 SASI_Rn02_00207385 predicted 671
5 SASI_Rn02_00207386 predicted 575
6 SASI_Rn02_00207387 predicted 1662
7 SASI_Rn02_00207388 predicted 1061
8 SASI_Rn02_00207389 predicted 948
9 SASI_Rn02_00207390 predicted 1605
10 SASI_Rn02_00207391 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268050 predicted 856
2 SASI_Rn01_00042814 predicted 602
3 SASI_Rn01_00042815 predicted 974
4 SASI_Rn01_00042817 predicted 2546
5 SASI_Rn01_00042819 predicted 1362
6 SASI_Rn01_00042820 predicted 1248
7 SASI_Rn01_00042821 predicted 1906
8 SASI_Rn02_00268051 predicted 1263
9 SASI_Rn02_00268052 predicted 1322
10 SASI_Rn02_00268053 predicted 959
11 SASI_Rn01_00042816 predicted 2018
12 SASI_Rn01_00042818 predicted 1403
13 SASI_Rn01_00042822 predicted 1994
14 SASI_Rn01_00042823 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298466 predicted 2257
2 SASI_Mm02_00298467 predicted 1606
3 SASI_Mm02_00298468 predicted 1254
4 SASI_Mm02_00298469 predicted 1662
5 SASI_Mm02_00298470 predicted 1650
6 SASI_Mm02_00298471 predicted 1214
7 SASI_Mm02_00298472 predicted 1663
8 SASI_Mm02_00298473 predicted 1616
9 SASI_Mm02_00298474 predicted 1466
10 SASI_Mm02_00298475 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064366 predicted 2262
2 SASI_Mm01_00064362 predicted 1608
3 SASI_Mm01_00064363 predicted 1250
4 SASI_Mm01_00064364 predicted 1662
5 SASI_Mm02_00320519 predicted 1647
6 SASI_Mm01_00064365 predicted 1214
7 SASI_Mm02_00320520 predicted 1656
8 SASI_Mm01_00064369 predicted 1613
9 SASI_Mm02_00320521 predicted 1461
10 SASI_Mm02_00320522 predicted 1334
11 SASI_Mm01_00064361 predicted 586
12 SASI_Mm01_00064367 predicted 1623
13 SASI_Mm01_00064368 predicted 716
14 SASI_Mm01_00064370 predicted 1712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015503
SH2B1 MISSION shRNA Bacterial Glycerol Stock
SH2B adaptor protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015503.2-3116s21c1
Sequence:CCGGTGACCGGGAGAACACGTTTGTCTCGAGACAAACGTGTTCTCCCGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015503.1-4228s1c1
Sequence:CCGGGAGAGGCAAGAGAAAGAGAAACTCGAGTTTCTCTTTCTCTTGCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3336s1c1
Sequence:CCGGCTGAATCACTCGGAGAGTCTACTCGAGTAGACTCTCCGAGTGATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-2689s1c1
Sequence:CCGGGAAACAGCAACTCCAACTCCTCTCGAGAGGAGTTGGAGTTGCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3145s1c1
Sequence:CCGGTGGAAGGTCCATCCGAGTATACTCGAGTATACTCGGATGGACCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015503.2-3956s21c1
Sequence:CCGGTGTTGTCCTTGTCAGCTATGTCTCGAGACATAGCTGACAAGGACAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3010s1c1
Sequence:CCGGGAAGTCGCCTGGAGTTCTTTGCTCGAGCAAAGAACTCCAGGCGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015503
SH2B1 MISSION shRNA shRNA Plasmid DNA
SH2B adaptor protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015503.2-3116s21c1
Sequence:CCGGTGACCGGGAGAACACGTTTGTCTCGAGACAAACGTGTTCTCCCGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015503.1-4228s1c1
Sequence:CCGGGAGAGGCAAGAGAAAGAGAAACTCGAGTTTCTCTTTCTCTTGCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3336s1c1
Sequence:CCGGCTGAATCACTCGGAGAGTCTACTCGAGTAGACTCTCCGAGTGATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-2689s1c1
Sequence:CCGGGAAACAGCAACTCCAACTCCTCTCGAGAGGAGTTGGAGTTGCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3145s1c1
Sequence:CCGGTGGAAGGTCCATCCGAGTATACTCGAGTATACTCGGATGGACCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015503.2-3956s21c1
Sequence:CCGGTGTTGTCCTTGTCAGCTATGTCTCGAGACATAGCTGACAAGGACAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3010s1c1
Sequence:CCGGGAAGTCGCCTGGAGTTCTTTGCTCGAGCAAAGAACTCCAGGCGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015503
SH2B1 MISSION shRNA Lentiviral Transduction Particles
SH2B adaptor protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015503.2-3116s21c1
Sequence:CCGGTGACCGGGAGAACACGTTTGTCTCGAGACAAACGTGTTCTCCCGGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015503.1-4228s1c1
Sequence:CCGGGAGAGGCAAGAGAAAGAGAAACTCGAGTTTCTCTTTCTCTTGCCTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3336s1c1
Sequence:CCGGCTGAATCACTCGGAGAGTCTACTCGAGTAGACTCTCCGAGTGATTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-2689s1c1
Sequence:CCGGGAAACAGCAACTCCAACTCCTCTCGAGAGGAGTTGGAGTTGCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3145s1c1
Sequence:CCGGTGGAAGGTCCATCCGAGTATACTCGAGTATACTCGGATGGACCTTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015503.2-3956s21c1
Sequence:CCGGTGTTGTCCTTGTCAGCTATGTCTCGAGACATAGCTGACAAGGACAACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015503.1-3010s1c1
Sequence:CCGGGAAGTCGCCTGGAGTTCTTTGCTCGAGCAAAGAACTCCAGGCGACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011363
VALIDATED
SH2B1 MISSION shRNA Bacterial Glycerol Stock
SH2B adaptor protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.1-1233s1c1
Sequence:CCGGCCTGAATCATTCAGAGAGTCTCTCGAGAGACTCTCTGAATGATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.1-1549s1c1
Sequence:CCGGGCTGCCCAGTTAGTGTTAGAACTCGAGTTCTAACACTAACTGGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.2-1554s1c1
Sequence:CCGGGCATTCCCTGCTCTACTATTACTCGAGTAATAGTAGAGCAGGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-1221s21c1
Sequence:CCGGTTGGTAGGGCATTGGCTAATGCTCGAGCATTAGCCAATGCCCTACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-3164s21c1
Sequence:CCGGAGGTTCATGAGCCCTGTTAAGCTCGAGCTTAACAGGGCTCATGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-2322s21c1
Sequence:CCGGACCTGCGCTTGTCACTAAATGCTCGAGCATTTAGTGACAAGCGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-2184s21c1
Sequence:CCGGGCATGCTCTCTCGACTCAAAGCTCGAGCTTTGAGTCGAGAGAGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-1553s21c1
Sequence:CCGGAGCATTCCCTGCTCTACTATTCTCGAGAATAGTAGAGCAGGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011363
VALIDATED
SH2B1 MISSION shRNA shRNA Plasmid DNA
SH2B adaptor protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.1-1233s1c1
Sequence:CCGGCCTGAATCATTCAGAGAGTCTCTCGAGAGACTCTCTGAATGATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.1-1549s1c1
Sequence:CCGGGCTGCCCAGTTAGTGTTAGAACTCGAGTTCTAACACTAACTGGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.2-1554s1c1
Sequence:CCGGGCATTCCCTGCTCTACTATTACTCGAGTAATAGTAGAGCAGGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-1221s21c1
Sequence:CCGGTTGGTAGGGCATTGGCTAATGCTCGAGCATTAGCCAATGCCCTACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-3164s21c1
Sequence:CCGGAGGTTCATGAGCCCTGTTAAGCTCGAGCTTAACAGGGCTCATGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-2322s21c1
Sequence:CCGGACCTGCGCTTGTCACTAAATGCTCGAGCATTTAGTGACAAGCGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-2184s21c1
Sequence:CCGGGCATGCTCTCTCGACTCAAAGCTCGAGCTTTGAGTCGAGAGAGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-1553s21c1
Sequence:CCGGAGCATTCCCTGCTCTACTATTCTCGAGAATAGTAGAGCAGGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011363
VALIDATED
SH2B1 MISSION shRNA Lentiviral Transduction Particles
SH2B adaptor protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.1-1233s1c1
Sequence:CCGGCCTGAATCATTCAGAGAGTCTCTCGAGAGACTCTCTGAATGATTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.1-1549s1c1
Sequence:CCGGGCTGCCCAGTTAGTGTTAGAACTCGAGTTCTAACACTAACTGGGCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011363.2-1554s1c1
Sequence:CCGGGCATTCCCTGCTCTACTATTACTCGAGTAATAGTAGAGCAGGGAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-1221s21c1
Sequence:CCGGTTGGTAGGGCATTGGCTAATGCTCGAGCATTAGCCAATGCCCTACCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-3164s21c1
Sequence:CCGGAGGTTCATGAGCCCTGTTAAGCTCGAGCTTAACAGGGCTCATGAACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-2322s21c1
Sequence:CCGGACCTGCGCTTGTCACTAAATGCTCGAGCATTTAGTGACAAGCGCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-2184s21c1
Sequence:CCGGGCATGCTCTCTCGACTCAAAGCTCGAGCTTTGAGTCGAGAGAGCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011363.2-1553s21c1
Sequence:CCGGAGCATTCCCTGCTCTACTATTCTCGAGAATAGTAGAGCAGGGAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)