EMAIL THIS PAGE TO A FRIEND

SH2B2

SH2B adaptor protein 2

43 Gene Product Result for
Synonyms: APS
UniProtKB ID: O14492, A6ND74
Gene ID:
Human(10603) Summary: The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
Mouse(23921) SH2B adaptor protein 2
Rat(114203) SH2B adaptor protein 2
chicken(771172) SH2B adaptor protein 2
domestic cat(101090410) SH2B adaptor protein 2
Horse(100060578) SH2B adaptor protein 2
dog(489820) SH2B adaptor protein 2
domestic guinea pig(100379265) SH2B adaptor protein 2
naked mole-rat(101724022) SH2B adaptor protein 2
cow(617840) SH2B adaptor protein 2
sheep(101117815) SH2B adaptor protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU082441 MISSION® esiRNA esiRNA targeting mouse Sh2b2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020979 Rosetta Predictions human pricing
NM_053669 Rosetta Predictions rat pricing
NM_018825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102047 predicted 1214
2 SASI_Hs02_00354423 predicted 947
3 SASI_Hs02_00354424 predicted 960
4 SASI_Hs02_00354425 predicted 885
5 SASI_Hs01_00102049 predicted 1125
6 SASI_Hs01_00102050 predicted 248
7 SASI_Hs02_00354426 predicted 1299
8 SASI_Hs02_00354427 predicted 531
9 SASI_Hs01_00102051 predicted 1481
10 SASI_Hs01_00102052 predicted 976
11 SASI_Hs01_00102048 predicted 946
12 SASI_Hs01_00102053 predicted 835
13 SASI_Hs01_00102054 predicted 311
14 SASI_Hs01_00102055 predicted 260
15 SASI_Hs01_00102056 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096316 predicted 1052
2 SASI_Rn01_00096318 predicted 2356
3 SASI_Rn01_00096319 predicted 2377
4 SASI_Rn01_00096320 predicted 2232
5 SASI_Rn01_00096321 predicted 1781
6 SASI_Rn01_00096322 predicted 365
7 SASI_Rn01_00096323 predicted 1383
8 SASI_Rn01_00096324 predicted 2241
9 SASI_Rn01_00096325 predicted 1560
10 SASI_Rn02_00266397 predicted 444
11 SASI_Rn01_00096317 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195355 predicted 664
2 SASI_Mm01_00195356 predicted 2272
3 SASI_Mm01_00195357 predicted 1596
4 SASI_Mm01_00195358 predicted 456
5 SASI_Mm01_00195359 predicted 1089
6 SASI_Mm01_00195360 predicted 392
7 SASI_Mm01_00195361 predicted 1124
8 SASI_Mm01_00195362 predicted 2385
9 SASI_Mm01_00195363 predicted 485
10 SASI_Mm01_00195364 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020979
SH2B2 MISSION shRNA Bacterial Glycerol Stock
SH2B adaptor protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-1486s1c1
Sequence:CCGGGTACGTGCTGACCTTCAACTTCTCGAGAAGTTGAAGGTCAGCACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-972s1c1
Sequence:CCGGCCGAATACATCTTGGAGACCACTCGAGTGGTCTCCAAGATGTATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020979.3-1697s21c1
Sequence:CCGGACATCACCCTTCGCAGCTATGCTCGAGCATAGCTGCGAAGGGTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020979.3-118s21c1
Sequence:CCCGTGGAGTTCAGCCCACTACTCTCTCGAGAGAGTAGTGGGCTGAACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-950s1c1
Sequence:CCGGGTCCTCAAGGTAGAGAATGGACTCGAGTCCATTCTCTACCTTGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-928s1c1
Sequence:CCGGGCCAGAGAAGGATAACACATTCTCGAGAATGTGTTATCCTTCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020979
SH2B2 MISSION shRNA shRNA Plasmid DNA
SH2B adaptor protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-1486s1c1
Sequence:CCGGGTACGTGCTGACCTTCAACTTCTCGAGAAGTTGAAGGTCAGCACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-972s1c1
Sequence:CCGGCCGAATACATCTTGGAGACCACTCGAGTGGTCTCCAAGATGTATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020979.3-1697s21c1
Sequence:CCGGACATCACCCTTCGCAGCTATGCTCGAGCATAGCTGCGAAGGGTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020979.3-118s21c1
Sequence:CCCGTGGAGTTCAGCCCACTACTCTCTCGAGAGAGTAGTGGGCTGAACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-950s1c1
Sequence:CCGGGTCCTCAAGGTAGAGAATGGACTCGAGTCCATTCTCTACCTTGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-928s1c1
Sequence:CCGGGCCAGAGAAGGATAACACATTCTCGAGAATGTGTTATCCTTCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020979
SH2B2 MISSION shRNA Lentiviral Transduction Particles
SH2B adaptor protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-1486s1c1
Sequence:CCGGGTACGTGCTGACCTTCAACTTCTCGAGAAGTTGAAGGTCAGCACGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-972s1c1
Sequence:CCGGCCGAATACATCTTGGAGACCACTCGAGTGGTCTCCAAGATGTATTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020979.3-1697s21c1
Sequence:CCGGACATCACCCTTCGCAGCTATGCTCGAGCATAGCTGCGAAGGGTGATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020979.3-118s21c1
Sequence:CCCGTGGAGTTCAGCCCACTACTCTCTCGAGAGAGTAGTGGGCTGAACTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-950s1c1
Sequence:CCGGGTCCTCAAGGTAGAGAATGGACTCGAGTCCATTCTCTACCTTGAGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020979.1-928s1c1
Sequence:CCGGGCCAGAGAAGGATAACACATTCTCGAGAATGTGTTATCCTTCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018825
SH2B2 MISSION shRNA Bacterial Glycerol Stock
SH2B adaptor protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018825.2-2459s1c1
Sequence:CCGGCCACTCCCATTAGCAGCTATTCTCGAGAATAGCTGCTAATGGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-2141s1c1
Sequence:CCGGGTGGAGAATCAGTACTCCTTTCTCGAGAAAGGAGTACTGATTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1791s1c1
Sequence:CCGGGATCGGCTGATATCACCCTAACTCGAGTTAGGGTGATATCAGCCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1794s1c1
Sequence:CCGGCGGCTGATATCACCCTAAGAACTCGAGTTCTTAGGGTGATATCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1122s1c1
Sequence:CCGGGAGCAGAATACATCCTGGAAACTCGAGTTTCCAGGATGTATTCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018825
SH2B2 MISSION shRNA shRNA Plasmid DNA
SH2B adaptor protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018825.2-2459s1c1
Sequence:CCGGCCACTCCCATTAGCAGCTATTCTCGAGAATAGCTGCTAATGGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-2141s1c1
Sequence:CCGGGTGGAGAATCAGTACTCCTTTCTCGAGAAAGGAGTACTGATTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1791s1c1
Sequence:CCGGGATCGGCTGATATCACCCTAACTCGAGTTAGGGTGATATCAGCCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1794s1c1
Sequence:CCGGCGGCTGATATCACCCTAAGAACTCGAGTTCTTAGGGTGATATCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1122s1c1
Sequence:CCGGGAGCAGAATACATCCTGGAAACTCGAGTTTCCAGGATGTATTCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018825
SH2B2 MISSION shRNA Lentiviral Transduction Particles
SH2B adaptor protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018825.2-2459s1c1
Sequence:CCGGCCACTCCCATTAGCAGCTATTCTCGAGAATAGCTGCTAATGGGAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-2141s1c1
Sequence:CCGGGTGGAGAATCAGTACTCCTTTCTCGAGAAAGGAGTACTGATTCTCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1791s1c1
Sequence:CCGGGATCGGCTGATATCACCCTAACTCGAGTTAGGGTGATATCAGCCGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1794s1c1
Sequence:CCGGCGGCTGATATCACCCTAAGAACTCGAGTTCTTAGGGTGATATCAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018825.2-1122s1c1
Sequence:CCGGGAGCAGAATACATCCTGGAAACTCGAGTTTCCAGGATGTATTCTGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)