EMAIL THIS PAGE TO A FRIEND

SH2B3

SH2B adaptor protein 3

146 Gene Product Result for
Synonyms: IDDM20 LNK
UniProtKB ID: Q9UQQ2, B9EGG5, O95184
Gene ID:
Human(10019) Summary: This gene encodes a member of the SH2B adaptor family of proteins, which are involved in a range of signaling activities by growth factor and cytokine receptors. The encoded protein is a key negative regulator of cytokine signaling and plays a critical role in hematopoiesis. Mutations in this gene have been associated with susceptibility to celiac disease type 13 and susceptibility to insulin-dependent diabetes mellitus.[provided by RefSeq, May 2010]
Mouse(16923) SH2B adaptor protein 3
Rat(58838) SH2B adaptor protein 3
cow(614726) SH2B adaptor protein 3
sheep(101105283) SH2B adaptor protein 3
naked mole-rat(101709458) SH2B adaptor protein 3
domestic guinea pig(100729040) SH2B adaptor protein 3
Zebrafish(573284) SH2B adaptor protein 3
domestic cat(101081760) SH2B adaptor protein 3
dog(100683018) SH2B adaptor protein 3
chicken(416876) SH2B adaptor protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005475 Rosetta Predictions human pricing
NM_031621 Rosetta Predictions rat pricing
XM_579519 Rosetta Predictions rat pricing
NM_008507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218419 predicted 2207
2 SASI_Hs01_00218420 predicted 1161
3 SASI_Hs01_00218423 predicted 1512
4 SASI_Hs02_00339652 predicted 2215
5 SASI_Hs01_00218424 predicted 2192
6 SASI_Hs01_00218425 predicted 1358
7 SASI_Hs01_00218427 predicted 1549
8 SASI_Hs02_00339653 predicted 2125
9 SASI_Hs01_00218428 predicted 2170
10 SASI_Hs02_00339654 predicted 2084
11 SASI_Hs01_00218421 predicted 1181
12 SASI_Hs01_00218422 predicted 2179
13 SASI_Hs01_00218426 predicted 2286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099623 predicted 875
2 SASI_Rn01_00099624 predicted 906
3 SASI_Rn01_00099625 predicted 662
4 SASI_Rn01_00099626 predicted 1283
5 SASI_Rn01_00099628 predicted 1646
6 SASI_Rn02_00264926 predicted 369
7 SASI_Rn01_00099629 predicted 1005
8 SASI_Rn01_00099630 predicted 949
9 SASI_Rn02_00264927 predicted 1669
10 SASI_Rn01_00099632 predicted 1842
11 SASI_Rn01_00099627 predicted 1595
12 SASI_Rn01_00099631 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172575 predicted 373
2 SASI_Rn01_00172576 predicted 1159
3 SASI_Rn01_00172577 predicted 1009
4 SASI_Rn01_00172578 predicted 952
5 SASI_Rn01_00172579 predicted 1151
6 SASI_Rn01_00172580 predicted 988
7 SASI_Rn01_00172581 predicted 289
8 SASI_Rn01_00172582 predicted 990
9 SASI_Rn01_00172583 predicted 1198
10 SASI_Rn01_00172584 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144816 predicted 1345
2 SASI_Mm01_00144817 predicted 1569
3 SASI_Mm01_00144818 predicted 2174
4 SASI_Mm01_00144819 predicted 1133
5 SASI_Mm01_00144820 predicted 1853
6 SASI_Mm01_00144821 predicted 1724
7 SASI_Mm02_00314060 predicted 2042
8 SASI_Mm01_00144822 predicted 678
9 SASI_Mm01_00144823 predicted 2057
10 SASI_Mm01_00144825 predicted 1906
11 SASI_Mm01_00144824 predicted 1732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005475
VALIDATED
SH2B3 MISSION shRNA Bacterial Glycerol Stock
SH2B adaptor protein 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-3057s21c1
Sequence:CCGGCCTAGGCCCTTTCTAGTAAATCTCGAGATTTACTAGAAAGGGCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1075s21c1
Sequence:CCGGTTCGACCCACCCAAGAGTTCACTCGAGTGAACTCTTGGGTGGGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1775s21c1
Sequence:CCGGACACGGTCCTCTTCCCTTTCTCTCGAGAGAAAGGGAAGAGGACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1411s21c1
Sequence:CCGGTGCCAGAAGACGGACCATTTCCTCGAGGAAATGGTCCGTCTTCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1559s21c1
Sequence:CCGGACGTGCTCACTTTCAACTTTCCTCGAGGAAAGTTGAAAGTGAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1310s21c1
Sequence:CCGGATATTCCCTCAGCCCTAGAGCCTCGAGGCTCTAGGGCTGAGGGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1981s21c1
Sequence:CCGGCTGGAGCATGAGCCTGTGAATCTCGAGATTCACAGGCTCATGCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1366s21c1
Sequence:CCGGTCCCTTAACCAAGGTGCTTCTCTCGAGAGAAGCACCTTGGTTAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-2948s21c1
Sequence:CCGGTCCTGGTGCCTTACGAATAAACTCGAGTTTATTCGTAAGGCACCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-2054s21c1
Sequence:CCGGGGGCCATAGACAATCAGTACACTCGAGTGTACTGATTGTCTATGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005475.1-4251s1c1
Sequence:CCGGCCCAGTAGATAATGAACCAAACTCGAGTTTGGTTCATTATCTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1162s1c1
Sequence:CCGGCCTGACAACCTTTACACCTTTCTCGAGAAAGGTGTAAAGGTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1161s1c1
Sequence:CCGGGCCTGACAACCTTTACACCTTCTCGAGAAGGTGTAAAGGTTGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1198s1c1
Sequence:CCGGGACCGGACAGACATCATCTTTCTCGAGAAAGATGATGTCTGTCCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-2015s1c1
Sequence:CCGGCGGACTACGAAATGGACTCATCTCGAGATGAGTCCATTTCGTAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005475
VALIDATED
SH2B3 MISSION shRNA shRNA Plasmid DNA
SH2B adaptor protein 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-3057s21c1
Sequence:CCGGCCTAGGCCCTTTCTAGTAAATCTCGAGATTTACTAGAAAGGGCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1075s21c1
Sequence:CCGGTTCGACCCACCCAAGAGTTCACTCGAGTGAACTCTTGGGTGGGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1775s21c1
Sequence:CCGGACACGGTCCTCTTCCCTTTCTCTCGAGAGAAAGGGAAGAGGACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1411s21c1
Sequence:CCGGTGCCAGAAGACGGACCATTTCCTCGAGGAAATGGTCCGTCTTCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1559s21c1
Sequence:CCGGACGTGCTCACTTTCAACTTTCCTCGAGGAAAGTTGAAAGTGAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1310s21c1
Sequence:CCGGATATTCCCTCAGCCCTAGAGCCTCGAGGCTCTAGGGCTGAGGGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1981s21c1
Sequence:CCGGCTGGAGCATGAGCCTGTGAATCTCGAGATTCACAGGCTCATGCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1366s21c1
Sequence:CCGGTCCCTTAACCAAGGTGCTTCTCTCGAGAGAAGCACCTTGGTTAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-2948s21c1
Sequence:CCGGTCCTGGTGCCTTACGAATAAACTCGAGTTTATTCGTAAGGCACCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-2054s21c1
Sequence:CCGGGGGCCATAGACAATCAGTACACTCGAGTGTACTGATTGTCTATGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005475.1-4251s1c1
Sequence:CCGGCCCAGTAGATAATGAACCAAACTCGAGTTTGGTTCATTATCTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1162s1c1
Sequence:CCGGCCTGACAACCTTTACACCTTTCTCGAGAAAGGTGTAAAGGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1161s1c1
Sequence:CCGGGCCTGACAACCTTTACACCTTCTCGAGAAGGTGTAAAGGTTGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1198s1c1
Sequence:CCGGGACCGGACAGACATCATCTTTCTCGAGAAAGATGATGTCTGTCCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-2015s1c1
Sequence:CCGGCGGACTACGAAATGGACTCATCTCGAGATGAGTCCATTTCGTAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005475
VALIDATED
SH2B3 MISSION shRNA Lentiviral Transduction Particles
SH2B adaptor protein 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-3057s21c1
Sequence:CCGGCCTAGGCCCTTTCTAGTAAATCTCGAGATTTACTAGAAAGGGCCTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1075s21c1
Sequence:CCGGTTCGACCCACCCAAGAGTTCACTCGAGTGAACTCTTGGGTGGGTCGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1775s21c1
Sequence:CCGGACACGGTCCTCTTCCCTTTCTCTCGAGAGAAAGGGAAGAGGACCGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1411s21c1
Sequence:CCGGTGCCAGAAGACGGACCATTTCCTCGAGGAAATGGTCCGTCTTCTGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1559s21c1
Sequence:CCGGACGTGCTCACTTTCAACTTTCCTCGAGGAAAGTTGAAAGTGAGCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1310s21c1
Sequence:CCGGATATTCCCTCAGCCCTAGAGCCTCGAGGCTCTAGGGCTGAGGGAATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1981s21c1
Sequence:CCGGCTGGAGCATGAGCCTGTGAATCTCGAGATTCACAGGCTCATGCTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-1366s21c1
Sequence:CCGGTCCCTTAACCAAGGTGCTTCTCTCGAGAGAAGCACCTTGGTTAAGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-2948s21c1
Sequence:CCGGTCCTGGTGCCTTACGAATAAACTCGAGTTTATTCGTAAGGCACCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005475.2-2054s21c1
Sequence:CCGGGGGCCATAGACAATCAGTACACTCGAGTGTACTGATTGTCTATGGCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005475.1-4251s1c1
Sequence:CCGGCCCAGTAGATAATGAACCAAACTCGAGTTTGGTTCATTATCTACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1162s1c1
Sequence:CCGGCCTGACAACCTTTACACCTTTCTCGAGAAAGGTGTAAAGGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1161s1c1
Sequence:CCGGGCCTGACAACCTTTACACCTTCTCGAGAAGGTGTAAAGGTTGTCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-1198s1c1
Sequence:CCGGGACCGGACAGACATCATCTTTCTCGAGAAAGATGATGTCTGTCCGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005475.1-2015s1c1
Sequence:CCGGCGGACTACGAAATGGACTCATCTCGAGATGAGTCCATTTCGTAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008507
SH2B3 MISSION shRNA Bacterial Glycerol Stock
SH2B adaptor protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1001s1c1
Sequence:CCGGCCTGACAACCTCTACACCTTTCTCGAGAAAGGTGTAGAGGTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1524s1c1
Sequence:CCGGGTTCTCCTATCCCACTGGAATCTCGAGATTCCAGTGGGATAGGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1523s1c1
Sequence:CCGGCGTTCTCCTATCCCACTGGAACTCGAGTTCCAGTGGGATAGGAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1396s1c1
Sequence:CCGGGTATGTACTCACATTCAACTTCTCGAGAAGTTGAATGTGAGTACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008507.2-2062s1c1
Sequence:CCGGCCACTGTTTACAGATGTAGTTCTCGAGAACTACATCTGTAAACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008507
SH2B3 MISSION shRNA shRNA Plasmid DNA
SH2B adaptor protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1001s1c1
Sequence:CCGGCCTGACAACCTCTACACCTTTCTCGAGAAAGGTGTAGAGGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1524s1c1
Sequence:CCGGGTTCTCCTATCCCACTGGAATCTCGAGATTCCAGTGGGATAGGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1523s1c1
Sequence:CCGGCGTTCTCCTATCCCACTGGAACTCGAGTTCCAGTGGGATAGGAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1396s1c1
Sequence:CCGGGTATGTACTCACATTCAACTTCTCGAGAAGTTGAATGTGAGTACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008507.2-2062s1c1
Sequence:CCGGCCACTGTTTACAGATGTAGTTCTCGAGAACTACATCTGTAAACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008507
SH2B3 MISSION shRNA Lentiviral Transduction Particles
SH2B adaptor protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1001s1c1
Sequence:CCGGCCTGACAACCTCTACACCTTTCTCGAGAAAGGTGTAGAGGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1524s1c1
Sequence:CCGGGTTCTCCTATCCCACTGGAATCTCGAGATTCCAGTGGGATAGGAGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1523s1c1
Sequence:CCGGCGTTCTCCTATCCCACTGGAACTCGAGTTCCAGTGGGATAGGAGAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008507.2-1396s1c1
Sequence:CCGGGTATGTACTCACATTCAACTTCTCGAGAAGTTGAATGTGAGTACATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008507.2-2062s1c1
Sequence:CCGGCCACTGTTTACAGATGTAGTTCTCGAGAACTACATCTGTAAACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)