EMAIL THIS PAGE TO A FRIEND

SH2D1A

SH2 domain containing 1A

166 Gene Product Result for
Synonyms: DSHP EBVS IMD5 LYP MTCP1 SAP SAP/SH2D1A XLP XLPD
Gene ID:
Human(4068) Summary: This gene encodes a protein that plays a major role in the bidirectional stimulation of T and B cells. This protein contains an SH2 domain and a short tail. It associates with the signaling lymphocyte-activation molecule, thereby acting as an inhibitor of this transmembrane protein by blocking the recruitment of the SH2-domain-containing signal-transduction molecule SHP-2 to its docking site. This protein can also bind to other related surface molecules that are expressed on activated T, B and NK cells, thereby modifying signal transduction pathways in these cells. Mutations in this gene cause lymphoproliferative syndrome X-linked type 1 or Duncan disease, a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus, with symptoms including severe mononucleosis and malignant lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20400) SH2 domain protein 1A
Rat(501502) SH2 domain containing 1A
domestic cat(101095723) SH2 domain containing 1A
dog(612899) SH2 domain containing 1A
domestic guinea pig(100722054) SH2 domain containing 1A
naked mole-rat(101723893) SH2 domain containing 1A
cow(613356) SH2 domain containing 1A
sheep(101117307) SH2 domain containing 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114937 Rosetta Predictions human pricing
NM_002351 Rosetta Predictions human pricing
NM_001109313 Rosetta Predictions rat pricing
NM_011364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326834 predicted 983
2 SASI_Hs02_00326835 predicted 1002
3 SASI_Hs02_00326836 predicted 1000
4 SASI_Hs02_00326837 predicted 1200
5 SASI_Hs02_00326838 predicted 1199
6 SASI_Hs02_00326839 predicted 946
7 SASI_Hs02_00326840 predicted 899
8 SASI_Hs02_00326841 predicted 774
9 SASI_Hs02_00326842 predicted 644
10 SASI_Hs02_00326843 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204579 predicted 987
2 SASI_Hs01_00204585 predicted 1014
3 SASI_Hs02_00333681 predicted 1014
4 SASI_Hs02_00333682 predicted 1208
5 SASI_Hs02_00333683 predicted 1210
6 SASI_Hs02_00333684 predicted 952
7 SASI_Hs02_00333685 predicted 899
8 SASI_Hs01_00204578 predicted 783
9 SASI_Hs01_00204580 predicted 645
10 SASI_Hs01_00204581 predicted 478
11 SASI_Hs01_00204582 predicted 815
12 SASI_Hs01_00204583 predicted 569
13 SASI_Hs01_00204584 predicted 641
14 SASI_Hs01_00204586 predicted 771
15 SASI_Hs01_00204587 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247194 predicted 564
2 SASI_Rn02_00247195 predicted 755
3 SASI_Rn02_00247196 predicted 751
4 SASI_Rn02_00247197 predicted 294
5 SASI_Rn02_00247198 predicted 723
6 SASI_Rn02_00247199 predicted 793
7 SASI_Rn02_00247200 predicted 841
8 SASI_Rn02_00247201 predicted 674
9 SASI_Rn02_00247202 predicted 456
10 SASI_Rn02_00247203 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100008 predicted 227
2 SASI_Mm01_00100009 predicted 292
3 SASI_Mm02_00320523 predicted 455
4 SASI_Mm01_00100010 predicted 313
5 SASI_Mm02_00320524 predicted 536
6 SASI_Mm01_00100011 predicted 528
7 SASI_Mm01_00100012 predicted 304
8 SASI_Mm01_00100013 predicted 472
9 SASI_Mm01_00100015 predicted 487
10 SASI_Mm01_00100016 predicted 226
11 SASI_Mm01_00100014 predicted 410
12 SASI_Mm01_00100017 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011364
SH2D1A MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-456s1c1
Sequence:CCGGACAGGGAGAAGAGATTCTGATCTCGAGATCAGAATCTCTTCTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-286s1c1
Sequence:CCGGCCCAGACAGAAACAGGTTCTTCTCGAGAAGAACCTGTTTCTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-258s1c1
Sequence:CCGGCAAGGTTACATCTACACATATCTCGAGATATGTGTAGATGTAACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011364.2-601s1c1
Sequence:CCGGGCACGACTCTAGTCCTGTAATCTCGAGATTACAGGACTAGAGTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-405s1c1
Sequence:CCGGCCTCTGCAGTATCCAGTTGAACTCGAGTTCAACTGGATACTGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011364
SH2D1A MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-456s1c1
Sequence:CCGGACAGGGAGAAGAGATTCTGATCTCGAGATCAGAATCTCTTCTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-286s1c1
Sequence:CCGGCCCAGACAGAAACAGGTTCTTCTCGAGAAGAACCTGTTTCTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-258s1c1
Sequence:CCGGCAAGGTTACATCTACACATATCTCGAGATATGTGTAGATGTAACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011364.2-601s1c1
Sequence:CCGGGCACGACTCTAGTCCTGTAATCTCGAGATTACAGGACTAGAGTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-405s1c1
Sequence:CCGGCCTCTGCAGTATCCAGTTGAACTCGAGTTCAACTGGATACTGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011364
SH2D1A MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-456s1c1
Sequence:CCGGACAGGGAGAAGAGATTCTGATCTCGAGATCAGAATCTCTTCTCCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-286s1c1
Sequence:CCGGCCCAGACAGAAACAGGTTCTTCTCGAGAAGAACCTGTTTCTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-258s1c1
Sequence:CCGGCAAGGTTACATCTACACATATCTCGAGATATGTGTAGATGTAACCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081158    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011364.2-601s1c1
Sequence:CCGGGCACGACTCTAGTCCTGTAATCTCGAGATTACAGGACTAGAGTCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011364.2-405s1c1
Sequence:CCGGCCTCTGCAGTATCCAGTTGAACTCGAGTTCAACTGGATACTGCAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002351
VALIDATED
SH2D1A MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 1A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002351.1-566s1c1
Sequence:CCGGGCCAGATCAAGGCATTGTAATCTCGAGATTACAATGCCTTGATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-432s1c1
Sequence:CCGGGTGCTGTATCACGGTTACATTCTCGAGAATGTAACCGTGATACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-555s1c1
Sequence:CCGGGCATTTCAGAAGCCAGATCAACTCGAGTTGATCTGGCTTCTGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-631s1c1
Sequence:CCGGCACAAGGTACTACAGGGATAACTCGAGTTATCCCTGTAGTACCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002351.1-1231s1c1
Sequence:CCGGGCAACCTTCTTGCCTAGTGTTCTCGAGAACACTAGGCAAGAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002351.3-806s21c1
Sequence:CCGGACAGTTCGGTGAGCTACAAATCTCGAGATTTGTAGCTCACCGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002351.3-479s21c1
Sequence:CCGGTGCTGTATCACGGTTACATTTCTCGAGAAATGTAACCGTGATACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002351.3-861s21c1
Sequence:CCGGGCATCTAGCATGTCGTCAAAGCTCGAGCTTTGACGACATGCTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002351
VALIDATED
SH2D1A MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 1A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002351.1-566s1c1
Sequence:CCGGGCCAGATCAAGGCATTGTAATCTCGAGATTACAATGCCTTGATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-432s1c1
Sequence:CCGGGTGCTGTATCACGGTTACATTCTCGAGAATGTAACCGTGATACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-555s1c1
Sequence:CCGGGCATTTCAGAAGCCAGATCAACTCGAGTTGATCTGGCTTCTGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-631s1c1
Sequence:CCGGCACAAGGTACTACAGGGATAACTCGAGTTATCCCTGTAGTACCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002351.1-1231s1c1
Sequence:CCGGGCAACCTTCTTGCCTAGTGTTCTCGAGAACACTAGGCAAGAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002351.3-806s21c1
Sequence:CCGGACAGTTCGGTGAGCTACAAATCTCGAGATTTGTAGCTCACCGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002351.3-479s21c1
Sequence:CCGGTGCTGTATCACGGTTACATTTCTCGAGAAATGTAACCGTGATACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002351.3-861s21c1
Sequence:CCGGGCATCTAGCATGTCGTCAAAGCTCGAGCTTTGACGACATGCTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002351
VALIDATED
SH2D1A MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 1A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002351.1-566s1c1
Sequence:CCGGGCCAGATCAAGGCATTGTAATCTCGAGATTACAATGCCTTGATCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-432s1c1
Sequence:CCGGGTGCTGTATCACGGTTACATTCTCGAGAATGTAACCGTGATACAGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-555s1c1
Sequence:CCGGGCATTTCAGAAGCCAGATCAACTCGAGTTGATCTGGCTTCTGAAATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002351.1-631s1c1
Sequence:CCGGCACAAGGTACTACAGGGATAACTCGAGTTATCCCTGTAGTACCTTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002351.1-1231s1c1
Sequence:CCGGGCAACCTTCTTGCCTAGTGTTCTCGAGAACACTAGGCAAGAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002351.3-806s21c1
Sequence:CCGGACAGTTCGGTGAGCTACAAATCTCGAGATTTGTAGCTCACCGAACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002351.3-479s21c1
Sequence:CCGGTGCTGTATCACGGTTACATTTCTCGAGAAATGTAACCGTGATACAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002351.3-861s21c1
Sequence:CCGGGCATCTAGCATGTCGTCAAAGCTCGAGCTTTGACGACATGCTAGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)