EMAIL THIS PAGE TO A FRIEND

SH2D1B

SH2 domain containing 1B

101 Gene Product Result for
Synonyms: EAT2
UniProtKB ID: O14796, B2RBN6, Q5T0L1, Q8NI18, Q969K9
Gene ID:
Human(117157) Summary: By binding phosphotyrosines through its free SRC (MIM 190090) homology-2 (SH2) domain, EAT2 regulates signal transduction through receptors expressed on the surface of antigen-presenting cells (Morra et al., 2001 [PubMed 11689425]
Rat(501869) SH2 domain containing 1B
chicken(418411) SH2 domain containing 1B
dog(609474) SH2 domain containing 1B
domestic cat(101083998) SH2 domain containing 1B
cow(617485) SH2 domain containing 1B
sheep(101108790) SH2 domain containing 1B
domestic guinea pig(101787221) SH2 domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053282 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097201 MISSION® esiRNA esiRNA human SH2D1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053282 Rosetta Predictions human pricing
XM_001076754 Rosetta Predictions rat pricing
XM_577285 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113778 predicted 441
2 SASI_Hs01_00113779 predicted 498
3 SASI_Hs01_00113780 predicted 271
4 SASI_Hs01_00113781 predicted 360
5 SASI_Hs01_00113782 predicted 345
6 SASI_Hs01_00113783 predicted 335
7 SASI_Hs01_00113784 predicted 553
8 SASI_Hs01_00113785 predicted 607
9 SASI_Hs01_00113786 predicted 290
10 SASI_Hs02_00361919 predicted 496
11 SASI_Hs01_00113787 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354406 predicted 332
2 SASI_Rn02_00354407 predicted 328
3 SASI_Rn02_00354408 predicted 278
4 SASI_Rn02_00354409 predicted 114
5 SASI_Rn02_00354410 predicted 279
6 SASI_Rn02_00354411 predicted 138
7 SASI_Rn02_00354412 predicted 332
8 SASI_Rn02_00354413 predicted 290
9 SASI_Rn02_00354414 predicted 213
10 SASI_Rn02_00354415 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175337 predicted 332
2 SASI_Rn01_00175338 predicted 332
3 SASI_Rn01_00175342 predicted 144
4 SASI_Rn02_00406424 predicted 336
5 SASI_Rn01_00175344 predicted 295
6 SASI_Rn02_00406425 predicted 202
7 SASI_Rn01_00175345 predicted 218
8 SASI_Rn02_00406426 predicted 329
9 SASI_Rn02_00406427 predicted 135
10 SASI_Rn01_00175346 predicted 230
11 SASI_Rn01_00175339 predicted 277
12 SASI_Rn01_00175340 predicted 124
13 SASI_Rn01_00175341 predicted 288
14 SASI_Rn01_00175343 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053282
SH2D1B MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 1B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053282.4-522s21c1
Sequence:CCGGAGATAAGGCTGCCGGACAAAGCTCGAGCTTTGTCCGGCAGCCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053282.4-483s21c1
Sequence:CCGGGTGAACAGTAACAGCGATTATCTCGAGATAATCGCTGTTACTGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-289s1c1
Sequence:CCGGTCAGAGAGAAACACGGGTATTCTCGAGAATACCCGTGTTTCTCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053282.4-1143s1c1
Sequence:CCGGCCTGGTTCTTTCTAATCTTAACTCGAGTTAAGATTAGAAAGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-356s1c1
Sequence:CCGGCCTAAAGGAACTGATCTCCAACTCGAGTTGGAGATCAGTTCCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-494s1c1
Sequence:CCGGCAGCGATTATGTGGATGTCTTCTCGAGAAGACATCCACATAATCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-452s1c1
Sequence:CCGGGAGAGGATTGAAATTAGAGTTCTCGAGAACTCTAATTTCAATCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053282.4-242s21c1
Sequence:CCGGGTGCCTCTGTGTCTCGTTTAACTCGAGTTAAACGAGACACAGAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053282
SH2D1B MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 1B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053282.4-522s21c1
Sequence:CCGGAGATAAGGCTGCCGGACAAAGCTCGAGCTTTGTCCGGCAGCCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053282.4-483s21c1
Sequence:CCGGGTGAACAGTAACAGCGATTATCTCGAGATAATCGCTGTTACTGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-289s1c1
Sequence:CCGGTCAGAGAGAAACACGGGTATTCTCGAGAATACCCGTGTTTCTCTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053282.4-1143s1c1
Sequence:CCGGCCTGGTTCTTTCTAATCTTAACTCGAGTTAAGATTAGAAAGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-356s1c1
Sequence:CCGGCCTAAAGGAACTGATCTCCAACTCGAGTTGGAGATCAGTTCCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-494s1c1
Sequence:CCGGCAGCGATTATGTGGATGTCTTCTCGAGAAGACATCCACATAATCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-452s1c1
Sequence:CCGGGAGAGGATTGAAATTAGAGTTCTCGAGAACTCTAATTTCAATCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053282.4-242s21c1
Sequence:CCGGGTGCCTCTGTGTCTCGTTTAACTCGAGTTAAACGAGACACAGAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053282
SH2D1B MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 1B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053282.4-522s21c1
Sequence:CCGGAGATAAGGCTGCCGGACAAAGCTCGAGCTTTGTCCGGCAGCCTTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053282.4-483s21c1
Sequence:CCGGGTGAACAGTAACAGCGATTATCTCGAGATAATCGCTGTTACTGTTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-289s1c1
Sequence:CCGGTCAGAGAGAAACACGGGTATTCTCGAGAATACCCGTGTTTCTCTCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053282.4-1143s1c1
Sequence:CCGGCCTGGTTCTTTCTAATCTTAACTCGAGTTAAGATTAGAAAGAACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-356s1c1
Sequence:CCGGCCTAAAGGAACTGATCTCCAACTCGAGTTGGAGATCAGTTCCTTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-494s1c1
Sequence:CCGGCAGCGATTATGTGGATGTCTTCTCGAGAAGACATCCACATAATCGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053282.4-452s1c1
Sequence:CCGGGAGAGGATTGAAATTAGAGTTCTCGAGAACTCTAATTTCAATCCTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053282.4-242s21c1
Sequence:CCGGGTGCCTCTGTGTCTCGTTTAACTCGAGTTAAACGAGACACAGAGGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)