EMAIL THIS PAGE TO A FRIEND

SH2D2A

SH2 domain containing 2A

91 Gene Product Result for
Synonyms: F2771 SCAP TSAD VRAP
UniProtKB ID: Q9NP31, O43817, Q5UBZ1, Q5VZS4, Q5VZS5, Q9UPA7
Gene ID:
Human(9047) Summary: This gene encodes an adaptor protein thought to function in T-cell signal transduction. A related protein in mouse is responsible for the activation of lymphocyte-specific protein-tyrosine kinase and functions in downstream signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(27371) SH2 domain protein 2A
Rat(310688) SH2 domain containing 2A
domestic guinea pig(100716286) SH2 domain containing 2A
naked mole-rat(101701381) SH2 domain containing 2A
cow(530059) SH2 domain containing 2A
sheep(101108005) SH2 domain containing 2A
chicken(425978) SH2 domain containing 2A
domestic cat(101082120) SH2 domain containing 2A
dog(100687395) SH2 domain containing 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154501 MISSION® esiRNA esiRNA human SH2D2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003975 Rosetta Predictions human pricing
NM_207605 Rosetta Predictions rat pricing
NM_001025571 Rosetta Predictions mouse pricing
NM_021309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119407 predicted 495
2 SASI_Hs01_00119408 predicted 502
3 SASI_Hs01_00119410 predicted 476
4 SASI_Hs02_00336667 predicted 920
5 SASI_Hs01_00119411 predicted 737
6 SASI_Hs01_00119412 predicted 875
7 SASI_Hs01_00119413 predicted 876
8 SASI_Hs01_00119415 predicted 694
9 SASI_Hs01_00119416 predicted 698
10 SASI_Hs02_00336668 predicted 477
11 SASI_Hs01_00119409 predicted 681
12 SASI_Hs01_00119414 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105543 predicted 506
2 SASI_Rn01_00105544 predicted 1176
3 SASI_Rn01_00105545 predicted 982
4 SASI_Rn01_00105546 predicted 1115
5 SASI_Rn01_00105547 predicted 994
6 SASI_Rn01_00105548 predicted 1053
7 SASI_Rn01_00105549 predicted 1015
8 SASI_Rn01_00105550 predicted 1265
9 SASI_Rn02_00270432 predicted 863
10 SASI_Rn02_00270433 predicted 578
11 SASI_Rn01_00105551 predicted 932
12 SASI_Rn01_00105552 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099978 predicted 1199
2 SASI_Mm01_00099979 predicted 1092
3 SASI_Mm01_00099980 predicted 1058
4 SASI_Mm01_00099982 predicted 460
5 SASI_Mm01_00099983 predicted 540
6 SASI_Mm01_00099984 predicted 1120
7 SASI_Mm02_00287918 predicted 303
8 SASI_Mm01_00099985 predicted 1204
9 SASI_Mm01_00099986 predicted 496
10 SASI_Mm01_00099987 predicted 1119
11 SASI_Mm01_00099981 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039445 predicted 1477
2 SASI_Mm01_00039446 predicted 1379
3 SASI_Mm01_00039447 predicted 1336
4 SASI_Mm01_00039449 predicted 721
5 SASI_Mm01_00039450 predicted 796
6 SASI_Mm01_00039451 predicted 1404
7 SASI_Mm02_00325854 predicted 553
8 SASI_Mm01_00039452 predicted 1480
9 SASI_Mm01_00039453 predicted 748
10 SASI_Mm01_00039454 predicted 1404
11 SASI_Mm01_00039448 predicted 1387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003975
SH2D2A MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 2A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1203s1c1
Sequence:CCGGCCACAATCTTTCTAGACAGGTCTCGAGACCTGTCTAGAAAGATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-921s1c1
Sequence:CCGGCAAGCCCTCCAATCCTATCTACTCGAGTAGATAGGATTGGAGGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-696s1c1
Sequence:CCGGGAGGACCGAAGAATCAAACTTCTCGAGAAGTTTGATTCTTCGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1125s1c1
Sequence:CCGGGCATTCTGAGAACTCTGTGATCTCGAGATCACAGAGTTCTCAGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1126s1c1
Sequence:CCGGCATTCTGAGAACTCTGTGATTCTCGAGAATCACAGAGTTCTCAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-952s1c1
Sequence:CCGGGATGAACCCATAGCTTTCTATCTCGAGATAGAAAGCTATGGGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-948s1c1
Sequence:CCGGGCCTGATGAACCCATAGCTTTCTCGAGAAAGCTATGGGTTCATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-874s1c1
Sequence:CCGGGAAGTCTACACAATCCCTGTTCTCGAGAACAGGGATTGTGTAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003975.2-1303s1c1
Sequence:CCGGCTGGAGGTCAGAGAAGCAAATCTCGAGATTTGCTTCTCTGACCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003975
SH2D2A MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 2A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1203s1c1
Sequence:CCGGCCACAATCTTTCTAGACAGGTCTCGAGACCTGTCTAGAAAGATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-921s1c1
Sequence:CCGGCAAGCCCTCCAATCCTATCTACTCGAGTAGATAGGATTGGAGGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-696s1c1
Sequence:CCGGGAGGACCGAAGAATCAAACTTCTCGAGAAGTTTGATTCTTCGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1125s1c1
Sequence:CCGGGCATTCTGAGAACTCTGTGATCTCGAGATCACAGAGTTCTCAGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1126s1c1
Sequence:CCGGCATTCTGAGAACTCTGTGATTCTCGAGAATCACAGAGTTCTCAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-952s1c1
Sequence:CCGGGATGAACCCATAGCTTTCTATCTCGAGATAGAAAGCTATGGGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-948s1c1
Sequence:CCGGGCCTGATGAACCCATAGCTTTCTCGAGAAAGCTATGGGTTCATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-874s1c1
Sequence:CCGGGAAGTCTACACAATCCCTGTTCTCGAGAACAGGGATTGTGTAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003975.2-1303s1c1
Sequence:CCGGCTGGAGGTCAGAGAAGCAAATCTCGAGATTTGCTTCTCTGACCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003975
SH2D2A MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 2A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1203s1c1
Sequence:CCGGCCACAATCTTTCTAGACAGGTCTCGAGACCTGTCTAGAAAGATTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-921s1c1
Sequence:CCGGCAAGCCCTCCAATCCTATCTACTCGAGTAGATAGGATTGGAGGGCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-696s1c1
Sequence:CCGGGAGGACCGAAGAATCAAACTTCTCGAGAAGTTTGATTCTTCGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1125s1c1
Sequence:CCGGGCATTCTGAGAACTCTGTGATCTCGAGATCACAGAGTTCTCAGAATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-1126s1c1
Sequence:CCGGCATTCTGAGAACTCTGTGATTCTCGAGAATCACAGAGTTCTCAGAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-952s1c1
Sequence:CCGGGATGAACCCATAGCTTTCTATCTCGAGATAGAAAGCTATGGGTTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-948s1c1
Sequence:CCGGGCCTGATGAACCCATAGCTTTCTCGAGAAAGCTATGGGTTCATCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003975.2-874s1c1
Sequence:CCGGGAAGTCTACACAATCCCTGTTCTCGAGAACAGGGATTGTGTAGACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003975.2-1303s1c1
Sequence:CCGGCTGGAGGTCAGAGAAGCAAATCTCGAGATTTGCTTCTCTGACCTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025571
SH2D2A MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025571.1-2161s1c1
Sequence:CCGGCCCACACCATATTTCTCCAAACTCGAGTTTGGAGAAATATGGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-1085s1c1
Sequence:CCGGCTATCTCAAGAGGCCAGGTAACTCGAGTTACCTGGCCTCTTGAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-189s1c1
Sequence:CCGGGCCCAGCATGCAAGTTATGAACTCGAGTTCATAACTTGCATGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-997s1c1
Sequence:CCGGGCTCCTAGTAATATCTATGCTCTCGAGAGCATAGATATTACTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-108s1c1
Sequence:CCGGAGCTACTTCATCAACCTTCAACTCGAGTTGAAGGTTGATGAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025571
SH2D2A MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025571.1-2161s1c1
Sequence:CCGGCCCACACCATATTTCTCCAAACTCGAGTTTGGAGAAATATGGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-1085s1c1
Sequence:CCGGCTATCTCAAGAGGCCAGGTAACTCGAGTTACCTGGCCTCTTGAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-189s1c1
Sequence:CCGGGCCCAGCATGCAAGTTATGAACTCGAGTTCATAACTTGCATGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-997s1c1
Sequence:CCGGGCTCCTAGTAATATCTATGCTCTCGAGAGCATAGATATTACTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-108s1c1
Sequence:CCGGAGCTACTTCATCAACCTTCAACTCGAGTTGAAGGTTGATGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025571
SH2D2A MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025571.1-2161s1c1
Sequence:CCGGCCCACACCATATTTCTCCAAACTCGAGTTTGGAGAAATATGGTGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-1085s1c1
Sequence:CCGGCTATCTCAAGAGGCCAGGTAACTCGAGTTACCTGGCCTCTTGAGATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-189s1c1
Sequence:CCGGGCCCAGCATGCAAGTTATGAACTCGAGTTCATAACTTGCATGCTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-997s1c1
Sequence:CCGGGCTCCTAGTAATATCTATGCTCTCGAGAGCATAGATATTACTAGGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025571.1-108s1c1
Sequence:CCGGAGCTACTTCATCAACCTTCAACTCGAGTTGAAGGTTGATGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)