EMAIL THIS PAGE TO A FRIEND

SH2D3C

SH2 domain containing 3C

109 Gene Product Result for
Synonyms: CHAT NSP3 PRO34088 SHEP1
Gene ID:
Human(10044) Summary: This gene encodes an adaptor protein and member of a cytoplasmic protein family involved in cell migration. The encoded protein contains a putative Src homology 2 (SH2) domain and guanine nucleotide exchange factor-like domain which allows this signaling protein to form a complex with scaffolding protein Crk-associated substrate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(27387) SH2 domain containing 3C
Rat(362111) SH2 domain containing 3C
domestic guinea pig(100726119) SH2 domain containing 3C
naked mole-rat(101723231) SH2 domain containing 3C
cow(515820) SH2 domain containing 3C
sheep(101102214) SH2 domain containing 3C
chicken(417225) SH2 domain containing 3C
Horse(100070448) SH2 domain containing 3C
domestic cat(101092558) SH2 domain containing 3C
dog(491326) SH2 domain containing 3C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406917 Anti-SH2D3C antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA047586 Anti-SH2D3C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB1410059 Anti-SH2D3C antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103630 Anti-SH2D3C, (N-terminal) antibody produced in rabbit affinity isolated antibody dog, guinea pig, rat, mouse, human, bovine, rabbit
western blot pricing
WH0010044M1 Monoclonal Anti-SH2D3C antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1408708 Monoclonal Anti-SH2D3C antibody produced in mouse clone 3D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408709 Monoclonal Anti-SH2D3C antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408710 Monoclonal Anti-SH2D3C antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408711 Monoclonal Anti-SH2D3C antibody produced in mouse clone 3C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408712 Monoclonal Anti-SH2D3C antibody produced in mouse clone 2B4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1408713 Monoclonal Anti-SH2D3C antibody produced in mouse clone 3C5, ascites fluid, solution human
ELISA, western blot pricing
SAB1404775 Monoclonal Anti-SH2D3C, (N-terminal) antibody produced in mouse clone 2E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005489 Rosetta Predictions human pricing
NM_170600 Rosetta Predictions human pricing
NM_001108579 Rosetta Predictions rat pricing
NM_013781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245182 predicted 1152
2 SASI_Hs01_00245183 predicted 560
3 SASI_Hs01_00245184 predicted 1144
4 SASI_Hs01_00245186 predicted 1294
5 SASI_Hs01_00245187 predicted 1144
6 SASI_Hs01_00245188 predicted 1268
7 SASI_Hs01_00245189 predicted 1150
8 SASI_Hs01_00245190 predicted 1346
9 SASI_Hs01_00245191 predicted 1245
10 SASI_Hs02_00339684 predicted 1211
11 SASI_Hs01_00245185 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077348 predicted 1581
2 SASI_Hs01_00077349 predicted 1003
3 SASI_Hs01_00077350 predicted 1583
4 SASI_Hs01_00077352 predicted 1730
5 SASI_Hs01_00077353 predicted 1585
6 SASI_Hs01_00077354 predicted 1702
7 SASI_Hs01_00077355 predicted 1588
8 SASI_Hs01_00077356 predicted 1782
9 SASI_Hs01_00077357 predicted 1676
10 SASI_Hs02_00367547 predicted 1647
11 SASI_Hs01_00077351 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240029 predicted 498
2 SASI_Rn02_00240030 predicted 339
3 SASI_Rn02_00240031 predicted 1267
4 SASI_Rn02_00240032 predicted 512
5 SASI_Rn02_00240033 predicted 429
6 SASI_Rn02_00240034 predicted 2255
7 SASI_Rn02_00240035 predicted 1718
8 SASI_Rn02_00240036 predicted 1973
9 SASI_Rn02_00240037 predicted 231
10 SASI_Rn02_00240038 predicted 1988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174449 predicted 1127
2 SASI_Mm01_00174450 predicted 2574
3 SASI_Mm01_00174452 predicted 2299
4 SASI_Mm01_00174453 predicted 2285
5 SASI_Mm01_00174454 predicted 454
6 SASI_Mm01_00174455 predicted 1720
7 SASI_Mm01_00174456 predicted 1419
8 SASI_Mm01_00174457 predicted 1144
9 SASI_Mm02_00322735 predicted 332
10 SASI_Mm01_00174451 predicted 421
11 SASI_Mm01_00174458 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005489
SH2D3C MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 3C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-1215s1c1
Sequence:CCGGCCATCGTGGAAGTCACTTCTTCTCGAGAAGAAGTGACTTCCACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-1568s1c1
Sequence:CCGGGCGCTGCTGCACAAGACCATTCTCGAGAATGGTCTTGTGCAGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-415s1c1
Sequence:CCGGCACACACATCCAGTACCTGTTCTCGAGAACAGGTACTGGATGTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-157s1c1
Sequence:CCGGCCTGGACTCATCGCCAGAGAACTCGAGTTCTCTGGCGATGAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-170s1c1
Sequence:CCGGCCAGAGAAACTCCACAAGGAACTCGAGTTCCTTGTGGAGTTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005489.2-2147s21c1
Sequence:CCGGGCGCTATGAGAAGTTCGACAACTCGAGTTGTCGAACTTCTCATAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005489.2-2309s21c1
Sequence:CCGGACTGTGATCAACCCGAGAATGCTCGAGCATTCTCGGGTTGATCACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005489.2-427s21c1
Sequence:CCGGCCTTGCACTTCAAGATCAACACTCGAGTGTTGATCTTGAAGTGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005489
SH2D3C MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 3C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-1215s1c1
Sequence:CCGGCCATCGTGGAAGTCACTTCTTCTCGAGAAGAAGTGACTTCCACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-1568s1c1
Sequence:CCGGGCGCTGCTGCACAAGACCATTCTCGAGAATGGTCTTGTGCAGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-415s1c1
Sequence:CCGGCACACACATCCAGTACCTGTTCTCGAGAACAGGTACTGGATGTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-157s1c1
Sequence:CCGGCCTGGACTCATCGCCAGAGAACTCGAGTTCTCTGGCGATGAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-170s1c1
Sequence:CCGGCCAGAGAAACTCCACAAGGAACTCGAGTTCCTTGTGGAGTTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005489.2-2147s21c1
Sequence:CCGGGCGCTATGAGAAGTTCGACAACTCGAGTTGTCGAACTTCTCATAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005489.2-2309s21c1
Sequence:CCGGACTGTGATCAACCCGAGAATGCTCGAGCATTCTCGGGTTGATCACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005489.2-427s21c1
Sequence:CCGGCCTTGCACTTCAAGATCAACACTCGAGTGTTGATCTTGAAGTGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005489
SH2D3C MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 3C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-1215s1c1
Sequence:CCGGCCATCGTGGAAGTCACTTCTTCTCGAGAAGAAGTGACTTCCACGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-1568s1c1
Sequence:CCGGGCGCTGCTGCACAAGACCATTCTCGAGAATGGTCTTGTGCAGCAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-415s1c1
Sequence:CCGGCACACACATCCAGTACCTGTTCTCGAGAACAGGTACTGGATGTGTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-157s1c1
Sequence:CCGGCCTGGACTCATCGCCAGAGAACTCGAGTTCTCTGGCGATGAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005489.1-170s1c1
Sequence:CCGGCCAGAGAAACTCCACAAGGAACTCGAGTTCCTTGTGGAGTTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005489.2-2147s21c1
Sequence:CCGGGCGCTATGAGAAGTTCGACAACTCGAGTTGTCGAACTTCTCATAGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005489.2-2309s21c1
Sequence:CCGGACTGTGATCAACCCGAGAATGCTCGAGCATTCTCGGGTTGATCACAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005489.2-427s21c1
Sequence:CCGGCCTTGCACTTCAAGATCAACACTCGAGTGTTGATCTTGAAGTGCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013781
SH2D3C MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 3C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013781.2-2750s1c1
Sequence:CCGGCCAAGAATGTTCTGGGTTCAACTCGAGTTGAACCCAGAACATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-1144s1c1
Sequence:CCGGCGAAGCATTACCATGACTGATCTCGAGATCAGTCATGGTAATGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-1417s1c1
Sequence:CCGGCCTCAGCTATGTCCTGGAAATCTCGAGATTTCCAGGACATAGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-2299s1c1
Sequence:CCGGCCACACGTACTTCCTTTCATTCTCGAGAATGAAAGGAAGTACGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-2575s1c1
Sequence:CCGGCGCTATGAGAAGTTTGACAAACTCGAGTTTGTCAAACTTCTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013781
SH2D3C MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 3C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013781.2-2750s1c1
Sequence:CCGGCCAAGAATGTTCTGGGTTCAACTCGAGTTGAACCCAGAACATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-1144s1c1
Sequence:CCGGCGAAGCATTACCATGACTGATCTCGAGATCAGTCATGGTAATGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-1417s1c1
Sequence:CCGGCCTCAGCTATGTCCTGGAAATCTCGAGATTTCCAGGACATAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-2299s1c1
Sequence:CCGGCCACACGTACTTCCTTTCATTCTCGAGAATGAAAGGAAGTACGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-2575s1c1
Sequence:CCGGCGCTATGAGAAGTTTGACAAACTCGAGTTTGTCAAACTTCTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013781
SH2D3C MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 3C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013781.2-2750s1c1
Sequence:CCGGCCAAGAATGTTCTGGGTTCAACTCGAGTTGAACCCAGAACATTCTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-1144s1c1
Sequence:CCGGCGAAGCATTACCATGACTGATCTCGAGATCAGTCATGGTAATGCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-1417s1c1
Sequence:CCGGCCTCAGCTATGTCCTGGAAATCTCGAGATTTCCAGGACATAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-2299s1c1
Sequence:CCGGCCACACGTACTTCCTTTCATTCTCGAGAATGAAAGGAAGTACGTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013781.2-2575s1c1
Sequence:CCGGCGCTATGAGAAGTTTGACAAACTCGAGTTTGTCAAACTTCTCATAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)