EMAIL THIS PAGE TO A FRIEND

SH2D4A

SH2 domain containing 4A

88 Gene Product Result for
Synonyms: PPP1R38 SH2A
Gene ID:
Mouse(72281) SH2 domain containing 4A
Rat(306376) SH2 domain containing 4A
chicken(422487) SH2 domain containing 4A
dog(475564) SH2 domain containing 4A
Horse(100052071) SH2 domain containing 4A
domestic cat(101096059) SH2 domain containing 4A
cow(506242) SH2 domain containing 4A
sheep(101102533) SH2 domain containing 4A
naked mole-rat(101699922) SH2 domain containing 4A
domestic guinea pig(100725168) SH2 domain containing 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047501 MISSION® esiRNA esiRNA human SH2D4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022071 Rosetta Predictions human pricing
NM_001012048 Rosetta Predictions rat pricing
XM_573893 Rosetta Predictions rat pricing
XM_001476079 Rosetta Predictions mouse pricing
XM_001476415 Rosetta Predictions mouse pricing
XM_134197 Rosetta Predictions mouse pricing
XM_895666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355436 predicted 522
2 SASI_Hs01_00096814 predicted 585
3 SASI_Hs01_00096815 predicted 1668
4 SASI_Hs01_00096817 predicted 690
5 SASI_Hs01_00096818 predicted 357
6 SASI_Hs01_00096819 predicted 1381
7 SASI_Hs02_00355437 predicted 679
8 SASI_Hs01_00096820 predicted 608
9 SASI_Hs01_00096822 predicted 602
10 SASI_Hs01_00096823 predicted 1801
11 SASI_Hs01_00096816 predicted 1465
12 SASI_Hs01_00096821 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079771 predicted 581
2 SASI_Rn01_00079772 predicted 1409
3 SASI_Rn01_00079773 predicted 1298
4 SASI_Rn01_00079774 predicted 1043
5 SASI_Rn01_00079775 predicted 563
6 SASI_Rn01_00079776 predicted 803
7 SASI_Rn01_00079777 predicted 703
8 SASI_Rn01_00079778 predicted 501
9 SASI_Rn01_00079779 predicted 1377
10 SASI_Rn01_00079780 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160901 predicted 587
2 SASI_Rn01_00160902 predicted 1406
3 SASI_Rn01_00160903 predicted 1299
4 SASI_Rn01_00160904 predicted 1039
5 SASI_Rn01_00160905 predicted 566
6 SASI_Rn01_00160906 predicted 806
7 SASI_Rn01_00160907 predicted 717
8 SASI_Rn01_00160908 predicted 506
9 SASI_Rn01_00160909 predicted 1380
10 SASI_Rn01_00160910 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00386824 predicted 1609
2 SASI_Mm02_00386825 predicted 757
3 SASI_Mm02_00386826 predicted 860
4 SASI_Mm02_00386827 predicted 1022
5 SASI_Mm02_00386828 predicted 757
6 SASI_Mm02_00386829 predicted 922
7 SASI_Mm02_00386830 predicted 844
8 SASI_Mm02_00386831 predicted 883
9 SASI_Mm02_00386832 predicted 892
10 SASI_Mm02_00386833 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00388909 predicted 1417
2 SASI_Mm02_00388910 predicted 1467
3 SASI_Mm02_00388911 predicted 1625
4 SASI_Mm02_00388912 predicted 753
5 SASI_Mm02_00388913 predicted 866
6 SASI_Mm02_00388914 predicted 1394
7 SASI_Mm02_00388915 predicted 1891
8 SASI_Mm02_00388916 predicted 920
9 SASI_Mm02_00388917 predicted 1703
10 SASI_Mm02_00388918 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216638 predicted 1690
2 SASI_Mm01_00216639 predicted 763
3 SASI_Mm01_00216640 predicted 1963
4 SASI_Mm01_00216641 predicted 925
5 SASI_Mm01_00216642 predicted 1772
6 SASI_Mm01_00216643 predicted 1458
7 SASI_Mm01_00216644 predicted 1077
8 SASI_Mm01_00216645 predicted 890
9 SASI_Mm01_00216646 predicted 820
10 SASI_Mm01_00216647 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202030 predicted 763
2 SASI_Mm01_00202031 predicted 869
3 SASI_Mm01_00202032 predicted 960
4 SASI_Mm01_00202033 predicted 931
5 SASI_Mm01_00202034 predicted 1376
6 SASI_Mm01_00202035 predicted 894
7 SASI_Mm01_00202036 predicted 827
8 SASI_Mm01_00202037 predicted 1391
9 SASI_Mm01_00202038 predicted 1409
10 SASI_Mm01_00202039 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022071
SH2D4A MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 4A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022071.2-2605s21c1
Sequence:CCGGCCCAAATCCAATGACTGGCATCTCGAGATGCCAGTCATTGGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-1010s21c1
Sequence:CCGGGCTGGAAAGAAGACTCGGAATCTCGAGATTCCGAGTCTTCTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-759s1c1
Sequence:CCGGGACTAAAGACATCTGGAAGAACTCGAGTTCTTCCAGATGTCTTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-759s21c1
Sequence:CCGGGACTAAAGACATCTGGAAGAACTCGAGTTCTTCCAGATGTCTTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-1458s21c1
Sequence:CCGGCAGTGAAAGGATCAAAGGCTACTCGAGTAGCCTTTGATCCTTTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1452s1c1
Sequence:CCGGCCGAGTCAGTGAAAGGATCAACTCGAGTTGATCCTTTCACTGACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1453s1c1
Sequence:CCGGCGAGTCAGTGAAAGGATCAAACTCGAGTTTGATCCTTTCACTGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022071.2-2605s1c1
Sequence:CCGGCCCAAATCCAATGACTGGCATCTCGAGATGCCAGTCATTGGATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1458s1c1
Sequence:CCGGCAGTGAAAGGATCAAAGGCTACTCGAGTAGCCTTTGATCCTTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1010s1c1
Sequence:CCGGGCTGGAAAGAAGACTCGGAATCTCGAGATTCCGAGTCTTCTTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022071
SH2D4A MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 4A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022071.2-2605s21c1
Sequence:CCGGCCCAAATCCAATGACTGGCATCTCGAGATGCCAGTCATTGGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-1010s21c1
Sequence:CCGGGCTGGAAAGAAGACTCGGAATCTCGAGATTCCGAGTCTTCTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-759s1c1
Sequence:CCGGGACTAAAGACATCTGGAAGAACTCGAGTTCTTCCAGATGTCTTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-759s21c1
Sequence:CCGGGACTAAAGACATCTGGAAGAACTCGAGTTCTTCCAGATGTCTTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-1458s21c1
Sequence:CCGGCAGTGAAAGGATCAAAGGCTACTCGAGTAGCCTTTGATCCTTTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1452s1c1
Sequence:CCGGCCGAGTCAGTGAAAGGATCAACTCGAGTTGATCCTTTCACTGACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1453s1c1
Sequence:CCGGCGAGTCAGTGAAAGGATCAAACTCGAGTTTGATCCTTTCACTGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022071.2-2605s1c1
Sequence:CCGGCCCAAATCCAATGACTGGCATCTCGAGATGCCAGTCATTGGATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1458s1c1
Sequence:CCGGCAGTGAAAGGATCAAAGGCTACTCGAGTAGCCTTTGATCCTTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1010s1c1
Sequence:CCGGGCTGGAAAGAAGACTCGGAATCTCGAGATTCCGAGTCTTCTTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022071
SH2D4A MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 4A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022071.2-2605s21c1
Sequence:CCGGCCCAAATCCAATGACTGGCATCTCGAGATGCCAGTCATTGGATTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-1010s21c1
Sequence:CCGGGCTGGAAAGAAGACTCGGAATCTCGAGATTCCGAGTCTTCTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-759s1c1
Sequence:CCGGGACTAAAGACATCTGGAAGAACTCGAGTTCTTCCAGATGTCTTTAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-759s21c1
Sequence:CCGGGACTAAAGACATCTGGAAGAACTCGAGTTCTTCCAGATGTCTTTAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022071.2-1458s21c1
Sequence:CCGGCAGTGAAAGGATCAAAGGCTACTCGAGTAGCCTTTGATCCTTTCACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1452s1c1
Sequence:CCGGCCGAGTCAGTGAAAGGATCAACTCGAGTTGATCCTTTCACTGACTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1453s1c1
Sequence:CCGGCGAGTCAGTGAAAGGATCAAACTCGAGTTTGATCCTTTCACTGACTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022071.2-2605s1c1
Sequence:CCGGCCCAAATCCAATGACTGGCATCTCGAGATGCCAGTCATTGGATTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1458s1c1
Sequence:CCGGCAGTGAAAGGATCAAAGGCTACTCGAGTAGCCTTTGATCCTTTCACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022071.2-1010s1c1
Sequence:CCGGGCTGGAAAGAAGACTCGGAATCTCGAGATTCCGAGTCTTCTTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028182
SH2D4A MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 4A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-890s21c1
Sequence:CCGGAGTCTCTAGAACTCGCCAATACTCGAGTATTGGCGAGTTCTAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1039s21c1
Sequence:CCGGGATGACAAAGCCCAAACTAAACTCGAGTTTAGTTTGGGCTTTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1183s21c1
Sequence:CCGGGATGAGAAGAGACGCTCTTTACTCGAGTAAAGAGCGTCTCTTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028182.1-2321s21c1
Sequence:CCGGGTCTGTTGGAGTGAGGTTATACTCGAGTATAACCTCACTCCAACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1342s21c1
Sequence:CCGGGGAATCCCTCCAAAGTCTTTACTCGAGTAAAGACTTTGGAGGGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028182
SH2D4A MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 4A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-890s21c1
Sequence:CCGGAGTCTCTAGAACTCGCCAATACTCGAGTATTGGCGAGTTCTAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1039s21c1
Sequence:CCGGGATGACAAAGCCCAAACTAAACTCGAGTTTAGTTTGGGCTTTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1183s21c1
Sequence:CCGGGATGAGAAGAGACGCTCTTTACTCGAGTAAAGAGCGTCTCTTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028182.1-2321s21c1
Sequence:CCGGGTCTGTTGGAGTGAGGTTATACTCGAGTATAACCTCACTCCAACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1342s21c1
Sequence:CCGGGGAATCCCTCCAAAGTCTTTACTCGAGTAAAGACTTTGGAGGGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028182
SH2D4A MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 4A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-890s21c1
Sequence:CCGGAGTCTCTAGAACTCGCCAATACTCGAGTATTGGCGAGTTCTAGAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1039s21c1
Sequence:CCGGGATGACAAAGCCCAAACTAAACTCGAGTTTAGTTTGGGCTTTGTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1183s21c1
Sequence:CCGGGATGAGAAGAGACGCTCTTTACTCGAGTAAAGAGCGTCTCTTCTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028182.1-2321s21c1
Sequence:CCGGGTCTGTTGGAGTGAGGTTATACTCGAGTATAACCTCACTCCAACAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028182.1-1342s21c1
Sequence:CCGGGGAATCCCTCCAAAGTCTTTACTCGAGTAAAGACTTTGGAGGGATTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)