EMAIL THIS PAGE TO A FRIEND

SH2D7

SH2 domain containing 7

54 Gene Product Result for
UniProtKB ID: A6NKC9
Gene ID:
Mouse(244885) SH2 domain containing 7
Rat(300718) SH2 domain containing 7
domestic cat(101091699) SH2 domain containing 7
Horse(100060049) SH2 domain containing 7
cow(100138339) SH2 domain containing 7
sheep(101114647) SH2 domain containing 7
naked mole-rat(101706871) SH2 domain containing 7
domestic guinea pig(100729322) SH2 domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050981 MISSION® esiRNA targeting human SH2D7 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101404 Rosetta Predictions human pricing
XM_929856 Rosetta Predictions human pricing
XM_001072462 Rosetta Predictions rat pricing
XM_236252 Rosetta Predictions rat pricing
NM_173778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322819 predicted 1064
2 SASI_Hs02_00322820 predicted 203
3 SASI_Hs02_00322821 predicted 1238
4 SASI_Hs02_00322822 predicted 844
5 SASI_Hs02_00322823 predicted 1275
6 SASI_Hs02_00322824 predicted 1277
7 SASI_Hs02_00322825 predicted 1327
8 SASI_Hs02_00322826 predicted 262
9 SASI_Hs02_00322827 predicted 262
10 SASI_Hs02_00322828 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267719 predicted 1189
2 SASI_Hs01_00267720 predicted 322
3 SASI_Hs01_00267721 predicted 745
4 SASI_Hs01_00267722 predicted 976
5 SASI_Hs01_00267723 predicted 216
6 SASI_Hs01_00267724 predicted 213
7 SASI_Hs01_00267725 predicted 399
8 SASI_Hs01_00267726 predicted 527
9 SASI_Hs01_00267727 predicted 214
10 SASI_Hs01_00267728 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339268 predicted 966
2 SASI_Rn02_00339269 predicted 1075
3 SASI_Rn02_00339270 predicted 924
4 SASI_Rn02_00339271 predicted 833
5 SASI_Rn02_00339272 predicted 237
6 SASI_Rn02_00339273 predicted 352
7 SASI_Rn02_00339274 predicted 296
8 SASI_Rn02_00339275 predicted 210
9 SASI_Rn02_00339276 predicted 901
10 SASI_Rn02_00339277 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389914 predicted 1298
2 SASI_Rn02_00389915 predicted 1149
3 SASI_Rn02_00389916 predicted 932
4 SASI_Rn02_00389917 predicted 527
5 SASI_Rn02_00389918 predicted 1327
6 SASI_Rn02_00389919 predicted 276
7 SASI_Rn02_00389920 predicted 585
8 SASI_Rn02_00389921 predicted 850
9 SASI_Rn02_00389922 predicted 842
10 SASI_Rn02_00389923 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065726 predicted 1130
2 SASI_Mm01_00065727 predicted 751
3 SASI_Mm01_00065728 predicted 1215
4 SASI_Mm01_00065729 predicted 913
5 SASI_Mm01_00065730 predicted 902
6 SASI_Mm01_00065731 predicted 1033
7 SASI_Mm01_00065732 predicted 1270
8 SASI_Mm01_00065733 predicted 1355
9 SASI_Mm01_00065734 predicted 824
10 SASI_Mm01_00065735 predicted 1386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101404
SH2D7 MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-1333s21c1
Sequence:CCGGACGTACAGGAAGCACAAATTCCTCGAGGAATTTGTGCTTCCTGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-270s21c1
Sequence:CCGGCAGTGATCGCTGCCGACATTTCTCGAGAAATGTCGGCAGCGATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-1034s21c1
Sequence:CCGGGCAGCTCTGCAGATATCTATGCTCGAGCATAGATATCTGCAGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101404.1-1703s21c1
Sequence:CCGGCTACTGAGCACTTACCGAATGCTCGAGCATTCGGTAAGTGCTCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101404
SH2D7 MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-1333s21c1
Sequence:CCGGACGTACAGGAAGCACAAATTCCTCGAGGAATTTGTGCTTCCTGTACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000255873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-270s21c1
Sequence:CCGGCAGTGATCGCTGCCGACATTTCTCGAGAAATGTCGGCAGCGATCACTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000265842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-1034s21c1
Sequence:CCGGGCAGCTCTGCAGATATCTATGCTCGAGCATAGATATCTGCAGAGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000265837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101404.1-1703s21c1
Sequence:CCGGCTACTGAGCACTTACCGAATGCTCGAGCATTCGGTAAGTGCTCAGTAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101404
SH2D7 MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-1333s21c1
Sequence:CCGGACGTACAGGAAGCACAAATTCCTCGAGGAATTTGTGCTTCCTGTACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-270s21c1
Sequence:CCGGCAGTGATCGCTGCCGACATTTCTCGAGAAATGTCGGCAGCGATCACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101404.1-1034s21c1
Sequence:CCGGGCAGCTCTGCAGATATCTATGCTCGAGCATAGATATCTGCAGAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101404.1-1703s21c1
Sequence:CCGGCTACTGAGCACTTACCGAATGCTCGAGCATTCGGTAAGTGCTCAGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173778
SH2D7 MISSION shRNA Bacterial Glycerol Stock
SH2 domain containing 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-626s21c1
Sequence:CCGGAGGCTCTACAATGCCTTATACCTCGAGGTATAAGGCATTGTAGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173778.3-1725s21c1
Sequence:CCGGTTGTGCTGCAGACACCTATTTCTCGAGAAATAGGTGTCTGCAGCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173778.2-297s1c1
Sequence:CCGGGCACAAGAAAGCCCTAGACATCTCGAGATGTCTAGGGCTTTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173778.2-445s1c1
Sequence:CCGGCTAAGGAAGATAAACCGGGCACTCGAGTGCCCGGTTTATCTTCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-752s21c1
Sequence:CCGGTGAAGCAAGCTCTACAGATACCTCGAGGTATCTGTAGAGCTTGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-902s21c1
Sequence:CCGGTCCCACATACAGCCAACAATCCTCGAGGATTGTTGGCTGTATGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-934s21c1
Sequence:CCGGACTATGGCTATGAGAAGATTTCTCGAGAAATCTTCTCATAGCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173778
SH2D7 MISSION shRNA shRNA Plasmid DNA
SH2 domain containing 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-626s21c1
Sequence:CCGGAGGCTCTACAATGCCTTATACCTCGAGGTATAAGGCATTGTAGAGCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173778.3-1725s21c1
Sequence:CCGGTTGTGCTGCAGACACCTATTTCTCGAGAAATAGGTGTCTGCAGCACAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000189789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173778.2-297s1c1
Sequence:CCGGGCACAAGAAAGCCCTAGACATCTCGAGATGTCTAGGGCTTTCTTGTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000190233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173778.2-445s1c1
Sequence:CCGGCTAAGGAAGATAAACCGGGCACTCGAGTGCCCGGTTTATCTTCCTTAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-752s21c1
Sequence:CCGGTGAAGCAAGCTCTACAGATACCTCGAGGTATCTGTAGAGCTTGCTTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-902s21c1
Sequence:CCGGTCCCACATACAGCCAACAATCCTCGAGGATTGTTGGCTGTATGTGGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-934s21c1
Sequence:CCGGACTATGGCTATGAGAAGATTTCTCGAGAAATCTTCTCATAGCCATAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173778
SH2D7 MISSION shRNA Lentiviral Transduction Particles
SH2 domain containing 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-626s21c1
Sequence:CCGGAGGCTCTACAATGCCTTATACCTCGAGGTATAAGGCATTGTAGAGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173778.3-1725s21c1
Sequence:CCGGTTGTGCTGCAGACACCTATTTCTCGAGAAATAGGTGTCTGCAGCACAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173778.2-297s1c1
Sequence:CCGGGCACAAGAAAGCCCTAGACATCTCGAGATGTCTAGGGCTTTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173778.2-445s1c1
Sequence:CCGGCTAAGGAAGATAAACCGGGCACTCGAGTGCCCGGTTTATCTTCCTTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-752s21c1
Sequence:CCGGTGAAGCAAGCTCTACAGATACCTCGAGGTATCTGTAGAGCTTGCTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-902s21c1
Sequence:CCGGTCCCACATACAGCCAACAATCCTCGAGGATTGTTGGCTGTATGTGGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173778.3-934s21c1
Sequence:CCGGACTATGGCTATGAGAAGATTTCTCGAGAAATCTTCTCATAGCCATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)