EMAIL THIS PAGE TO A FRIEND

SH3BGR

SH3 domain binding glutamic acid-rich protein

53 Gene Product Result for
Synonyms: 21-GARP
UniProtKB ID: P55822, A6ND59, D3DSI2, Q9BRB8
Gene ID:
Mouse(50795) SH3-binding domain glutamic acid-rich protein
Rat(498066) SH3 domain binding glutamic acid-rich protein
Zebrafish(445130) SH3 domain binding glutamic acid-rich protein
chicken(418523) SH3 domain binding glutamic acid-rich protein
dog(487765) SH3 domain binding glutamic acid-rich protein
cow(617797) SH3 domain binding glutamic acid-rich protein
sheep(101123341) SH3 domain binding glutamic acid-rich protein
domestic guinea pig(100735992) SH3 domain binding glutamic acid-rich protein
naked mole-rat(101712456) SH3 domain binding glutamic acid-rich protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001713 Rosetta Predictions human pricing
NM_007341 Rosetta Predictions human pricing
NM_001127682 Rosetta Predictions rat pricing
NM_015825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039005 predicted 878
2 SASI_Hs01_00039006 predicted 951
3 SASI_Hs01_00039007 predicted 912
4 SASI_Hs01_00039008 predicted 691
5 SASI_Hs01_00039009 predicted 733
6 SASI_Hs01_00039010 predicted 824
7 SASI_Hs01_00039011 predicted 706
8 SASI_Hs01_00039012 predicted 370
9 SASI_Hs01_00039013 predicted 580
10 SASI_Hs01_00039014 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010333 predicted 246
2 SASI_Hs01_00010334 predicted 822
3 SASI_Hs01_00010335 predicted 366
4 SASI_Hs01_00010336 predicted 346
5 SASI_Hs01_00010337 predicted 606
6 SASI_Hs01_00010338 predicted 809
7 SASI_Hs01_00010339 predicted 388
8 SASI_Hs01_00010340 predicted 167
9 SASI_Hs01_00010341 predicted 150
10 SASI_Hs01_00010342 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254850 predicted 199
2 SASI_Rn02_00254851 predicted 310
3 SASI_Rn02_00254852 predicted 194
4 SASI_Rn02_00254853 predicted 923
5 SASI_Rn02_00254854 predicted 335
6 SASI_Rn02_00254855 predicted 312
7 SASI_Rn02_00254856 predicted 318
8 SASI_Rn02_00254857 predicted 320
9 SASI_Rn02_00254858 predicted 919
10 SASI_Rn02_00254859 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027130 predicted 292
2 SASI_Mm01_00027133 predicted 240
3 SASI_Mm01_00027134 predicted 406
4 SASI_Mm02_00323239 predicted 1065
5 SASI_Mm02_00323240 predicted 233
6 SASI_Mm02_00323241 predicted 432
7 SASI_Mm02_00323242 predicted 1046
8 SASI_Mm01_00027127 predicted 461
9 SASI_Mm01_00027128 predicted 471
10 SASI_Mm02_00323243 predicted 1038
11 SASI_Mm01_00027129 predicted 235
12 SASI_Mm01_00027131 predicted 426
13 SASI_Mm01_00027132 predicted 34
14 SASI_Mm01_00027135 predicted 314
15 SASI_Mm01_00027136 predicted 30
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007341
SH3BGR MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-249s1c1
Sequence:CCGGGCGATTAGGAAGAAACAGCAACTCGAGTTGCTGTTTCTTCCTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-684s1c1
Sequence:CCGGGAGGAGGAAGAAACTGCAGAACTCGAGTTCTGCAGTTTCTTCCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-410s1c1
Sequence:CCGGGATCTTCAATGAGGAGCAGTACTCGAGTACTGCTCCTCATTGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-325s1c1
Sequence:CCGGCTGGAGATGAAGACAACAGGACTCGAGTCCTGTTGTCTTCATCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-966s21c1
Sequence:CCGGTAAATGTGAAGACCGTTTATGCTCGAGCATAAACGGTCTTCACATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-407s1c1
Sequence:CCGGCCAGATCTTCAATGAGGAGCACTCGAGTGCTCCTCATTGAAGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-690s1c1
Sequence:CCGGGAAGAAACTGCAGAAGGAGAACTCGAGTTCTCCTTCTGCAGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-130s1c1
Sequence:CCGGGTCACTGTCAGGATTTGTCTACTCGAGTAGACAAATCCTGACAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-353s1c1
Sequence:CCGGGAGAGAGAATGTTCCTGGAGACTCGAGTCTCCAGGAACATTCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-892s21c1
Sequence:CCGGCCAGGGTTACTGAGGACTTATCTCGAGATAAGTCCTCAGTAACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-814s21c1
Sequence:CCGGGGAAGCTATGAAGCAACATTTCTCGAGAAATGTTGCTTCATAGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-940s21c1
Sequence:CCGGGAGGTATCTCCCGAATCATACCTCGAGGTATGATTCGGGAGATACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007341
SH3BGR MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-249s1c1
Sequence:CCGGGCGATTAGGAAGAAACAGCAACTCGAGTTGCTGTTTCTTCCTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-684s1c1
Sequence:CCGGGAGGAGGAAGAAACTGCAGAACTCGAGTTCTGCAGTTTCTTCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-410s1c1
Sequence:CCGGGATCTTCAATGAGGAGCAGTACTCGAGTACTGCTCCTCATTGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-325s1c1
Sequence:CCGGCTGGAGATGAAGACAACAGGACTCGAGTCCTGTTGTCTTCATCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-966s21c1
Sequence:CCGGTAAATGTGAAGACCGTTTATGCTCGAGCATAAACGGTCTTCACATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-407s1c1
Sequence:CCGGCCAGATCTTCAATGAGGAGCACTCGAGTGCTCCTCATTGAAGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-690s1c1
Sequence:CCGGGAAGAAACTGCAGAAGGAGAACTCGAGTTCTCCTTCTGCAGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-130s1c1
Sequence:CCGGGTCACTGTCAGGATTTGTCTACTCGAGTAGACAAATCCTGACAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-353s1c1
Sequence:CCGGGAGAGAGAATGTTCCTGGAGACTCGAGTCTCCAGGAACATTCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-892s21c1
Sequence:CCGGCCAGGGTTACTGAGGACTTATCTCGAGATAAGTCCTCAGTAACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-814s21c1
Sequence:CCGGGGAAGCTATGAAGCAACATTTCTCGAGAAATGTTGCTTCATAGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-940s21c1
Sequence:CCGGGAGGTATCTCCCGAATCATACCTCGAGGTATGATTCGGGAGATACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007341
SH3BGR MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-249s1c1
Sequence:CCGGGCGATTAGGAAGAAACAGCAACTCGAGTTGCTGTTTCTTCCTAATCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-684s1c1
Sequence:CCGGGAGGAGGAAGAAACTGCAGAACTCGAGTTCTGCAGTTTCTTCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-410s1c1
Sequence:CCGGGATCTTCAATGAGGAGCAGTACTCGAGTACTGCTCCTCATTGAAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-325s1c1
Sequence:CCGGCTGGAGATGAAGACAACAGGACTCGAGTCCTGTTGTCTTCATCTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-966s21c1
Sequence:CCGGTAAATGTGAAGACCGTTTATGCTCGAGCATAAACGGTCTTCACATTTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-407s1c1
Sequence:CCGGCCAGATCTTCAATGAGGAGCACTCGAGTGCTCCTCATTGAAGATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-690s1c1
Sequence:CCGGGAAGAAACTGCAGAAGGAGAACTCGAGTTCTCCTTCTGCAGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-130s1c1
Sequence:CCGGGTCACTGTCAGGATTTGTCTACTCGAGTAGACAAATCCTGACAGTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007341.1-353s1c1
Sequence:CCGGGAGAGAGAATGTTCCTGGAGACTCGAGTCTCCAGGAACATTCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-892s21c1
Sequence:CCGGCCAGGGTTACTGAGGACTTATCTCGAGATAAGTCCTCAGTAACCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-814s21c1
Sequence:CCGGGGAAGCTATGAAGCAACATTTCTCGAGAAATGTTGCTTCATAGCTTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007341.2-940s21c1
Sequence:CCGGGAGGTATCTCCCGAATCATACCTCGAGGTATGATTCGGGAGATACCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015825
SH3BGR MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015825.2-781s21c1
Sequence:CCGGACAACAGGAGAGACGGAAGAGCTCGAGCTCTTCCGTCTCTCCTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015825.2-896s21c1
Sequence:CCGGCTTCAACTTTCCCAGAATATCCTCGAGGATATTCTGGGAAAGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-465s1c1
Sequence:CCGGCCAAGAGAAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTTCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-135s1c1
Sequence:CCGGCAGAAAGTGGATGAGAGAGAACTCGAGTTCTCTCTCATCCACTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015825.2-1100s21c1
Sequence:CCGGCGCGTACGCTGCCTGAAATTTCTCGAGAAATTTCAGGCAGCGTACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-97s1c1
Sequence:CCGGGACTTCAAGGAGCTGGACATACTCGAGTATGTCCAGCTCCTTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-421s1c1
Sequence:CCGGGCACAGAAAGAGGACAGTGAACTCGAGTTCACTGTCCTCTTTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015825
SH3BGR MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015825.2-781s21c1
Sequence:CCGGACAACAGGAGAGACGGAAGAGCTCGAGCTCTTCCGTCTCTCCTGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015825.2-896s21c1
Sequence:CCGGCTTCAACTTTCCCAGAATATCCTCGAGGATATTCTGGGAAAGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-465s1c1
Sequence:CCGGCCAAGAGAAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-135s1c1
Sequence:CCGGCAGAAAGTGGATGAGAGAGAACTCGAGTTCTCTCTCATCCACTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015825.2-1100s21c1
Sequence:CCGGCGCGTACGCTGCCTGAAATTTCTCGAGAAATTTCAGGCAGCGTACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-97s1c1
Sequence:CCGGGACTTCAAGGAGCTGGACATACTCGAGTATGTCCAGCTCCTTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-421s1c1
Sequence:CCGGGCACAGAAAGAGGACAGTGAACTCGAGTTCACTGTCCTCTTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015825
SH3BGR MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015825.2-781s21c1
Sequence:CCGGACAACAGGAGAGACGGAAGAGCTCGAGCTCTTCCGTCTCTCCTGTTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015825.2-896s21c1
Sequence:CCGGCTTCAACTTTCCCAGAATATCCTCGAGGATATTCTGGGAAAGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-465s1c1
Sequence:CCGGCCAAGAGAAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTTCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-135s1c1
Sequence:CCGGCAGAAAGTGGATGAGAGAGAACTCGAGTTCTCTCTCATCCACTTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015825.2-1100s21c1
Sequence:CCGGCGCGTACGCTGCCTGAAATTTCTCGAGAAATTTCAGGCAGCGTACGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-97s1c1
Sequence:CCGGGACTTCAAGGAGCTGGACATACTCGAGTATGTCCAGCTCCTTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015825.1-421s1c1
Sequence:CCGGGCACAGAAAGAGGACAGTGAACTCGAGTTCACTGTCCTCTTTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)