EMAIL THIS PAGE TO A FRIEND

SH3BGRL2

SH3 domain binding glutamic acid-rich protein like 2

229 Gene Product Result for
Gene ID:
Mouse(212531) SH3 domain binding glutamic acid-rich protein like 2
Rat(501026) SH3 domain binding glutamic acid-rich protein like 2
Zebrafish(431744) SH3 domain binding glutamic acid-rich protein like 2
dog(474977) SH3 domain binding glutamic acid-rich protein like 2
chicken(421851) SH3 domain binding glutamic acid-rich protein like 2
cow(785404) SH3 domain binding glutamic acid-rich protein like 2
domestic guinea pig(100719552) SH3 domain binding glutamic acid-rich protein like 2
naked mole-rat(101701229) SH3 domain binding glutamic acid-rich protein like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047486 Anti-SH3BGRL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031469 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028751 MISSION® esiRNA esiRNA human SH3BGRL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031469 Rosetta Predictions human pricing
XM_001062112 Rosetta Predictions rat pricing
XM_576437 Rosetta Predictions rat pricing
NM_172507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189285 predicted 954
2 SASI_Hs01_00189278 predicted 986
3 SASI_Hs01_00189279 predicted 908
4 SASI_Hs01_00189283 predicted 474
5 SASI_Hs01_00189284 predicted 858
6 SASI_Hs01_00189286 predicted 887
7 SASI_Hs01_00189287 predicted 182
8 SASI_Hs02_00358893 predicted 841
9 SASI_Hs02_00358894 predicted 851
10 SASI_Hs02_00358895 predicted 958
11 SASI_Hs01_00189280 predicted 298
12 SASI_Hs01_00189281 predicted 280
13 SASI_Hs01_00189282 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302419 predicted 907
2 SASI_Rn02_00302420 predicted 875
3 SASI_Rn02_00302421 predicted 654
4 SASI_Rn02_00302422 predicted 720
5 SASI_Rn02_00302423 predicted 762
6 SASI_Rn02_00302424 predicted 814
7 SASI_Rn02_00302425 predicted 956
8 SASI_Rn02_00302426 predicted 391
9 SASI_Rn02_00302427 predicted 748
10 SASI_Rn02_00302428 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405320 predicted 908
2 SASI_Rn02_00405321 predicted 873
3 SASI_Rn02_00405322 predicted 650
4 SASI_Rn02_00405323 predicted 717
5 SASI_Rn02_00405324 predicted 765
6 SASI_Rn02_00405325 predicted 816
7 SASI_Rn02_00405326 predicted 953
8 SASI_Rn02_00405327 predicted 388
9 SASI_Rn02_00405328 predicted 748
10 SASI_Rn02_00405329 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094272 predicted 901
2 SASI_Mm01_00094273 predicted 699
3 SASI_Mm01_00094275 predicted 717
4 SASI_Mm01_00094276 predicted 759
5 SASI_Mm01_00094277 predicted 892
6 SASI_Mm01_00094279 predicted 572
7 SASI_Mm01_00094280 predicted 670
8 SASI_Mm01_00094281 predicted 603
9 SASI_Mm02_00344095 predicted 417
10 SASI_Mm02_00344096 predicted 702
11 SASI_Mm01_00094274 predicted 221
12 SASI_Mm01_00094278 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172507
VALIDATED
SH3BGRL2 MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-376s21c1
Sequence:CCGGGAAGGAAAGCAACACAGTCTTCTCGAGAAGACTGTGTTGCTTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172507.2-224s1c1
Sequence:CCGGGATGTGGTTCGGTTTCTGGAACTCGAGTTCCAGAAACCGAACCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172507.2-351s1c1
Sequence:CCGGCTCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172507.2-415s1c1
Sequence:CCGGGAAGGAAAGCAACACAGTCTTCTCGAGAAGACTGTGTTGCTTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172507.2-272s1c1
Sequence:CCGGGACATCACCATGTCGGAAGAACTCGAGTTCTTCCGACATGGTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172507.2-3233s1c1
Sequence:CCGGCCCAGTATTTACATTTCCATACTCGAGTATGGAAATGTAAATACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172507.5-3196s21c1
Sequence:CCGGCCCAGTATTTACATTTCCATACTCGAGTATGGAAATGTAAATACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-233s21c1
Sequence:CCGGGACATCACCATGTCGGAAGAACTCGAGTTCTTCCGACATGGTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-312s21c1
Sequence:CCGGCTCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-185s21c1
Sequence:CCGGGATGTGGTTCGGTTTCTGGAACTCGAGTTCCAGAAACCGAACCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172507
VALIDATED
SH3BGRL2 MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-376s21c1
Sequence:CCGGGAAGGAAAGCAACACAGTCTTCTCGAGAAGACTGTGTTGCTTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172507.2-224s1c1
Sequence:CCGGGATGTGGTTCGGTTTCTGGAACTCGAGTTCCAGAAACCGAACCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172507.2-351s1c1
Sequence:CCGGCTCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172507.2-415s1c1
Sequence:CCGGGAAGGAAAGCAACACAGTCTTCTCGAGAAGACTGTGTTGCTTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172507.2-272s1c1
Sequence:CCGGGACATCACCATGTCGGAAGAACTCGAGTTCTTCCGACATGGTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172507.2-3233s1c1
Sequence:CCGGCCCAGTATTTACATTTCCATACTCGAGTATGGAAATGTAAATACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172507.5-3196s21c1
Sequence:CCGGCCCAGTATTTACATTTCCATACTCGAGTATGGAAATGTAAATACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-233s21c1
Sequence:CCGGGACATCACCATGTCGGAAGAACTCGAGTTCTTCCGACATGGTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-312s21c1
Sequence:CCGGCTCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-185s21c1
Sequence:CCGGGATGTGGTTCGGTTTCTGGAACTCGAGTTCCAGAAACCGAACCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172507
VALIDATED
SH3BGRL2 MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-376s21c1
Sequence:CCGGGAAGGAAAGCAACACAGTCTTCTCGAGAAGACTGTGTTGCTTTCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172507.2-224s1c1
Sequence:CCGGGATGTGGTTCGGTTTCTGGAACTCGAGTTCCAGAAACCGAACCACATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172507.2-351s1c1
Sequence:CCGGCTCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172507.2-415s1c1
Sequence:CCGGGAAGGAAAGCAACACAGTCTTCTCGAGAAGACTGTGTTGCTTTCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172507.2-272s1c1
Sequence:CCGGGACATCACCATGTCGGAAGAACTCGAGTTCTTCCGACATGGTGATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172507.2-3233s1c1
Sequence:CCGGCCCAGTATTTACATTTCCATACTCGAGTATGGAAATGTAAATACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172507.5-3196s21c1
Sequence:CCGGCCCAGTATTTACATTTCCATACTCGAGTATGGAAATGTAAATACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-233s21c1
Sequence:CCGGGACATCACCATGTCGGAAGAACTCGAGTTCTTCCGACATGGTGATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-312s21c1
Sequence:CCGGCTCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172507.5-185s21c1
Sequence:CCGGGATGTGGTTCGGTTTCTGGAACTCGAGTTCCAGAAACCGAACCACATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031469
VALIDATED
SH3BGRL2 MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein like 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-470s1c1
Sequence:CCGGGAAACCACGGTTGGCATCAAACTCGAGTTTGATGCCAACCGTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-370s1c1
Sequence:CCGGCCCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-215s1c1
Sequence:CCGGCTTCGTGGCGATAAAGAAGAACTCGAGTTCTTCTTTATCGCCACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-261s1c1
Sequence:CCGGGAAGCCAACAAGATAGAGTTTCTCGAGAAACTCTATCTTGTTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-237s1c1
Sequence:CCGGCAGCAAGATGTGGTTAGATTTCTCGAGAAATCTAACCACATCTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-383s1c1
Sequence:CCGGGATATTTAATGGCGACCGATACTCGAGTATCGGTCGCCATTAAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031469.1-2975s1c1
Sequence:CCGGGCAAAGGAAATGTGCTGCTAACTCGAGTTAGCAGCACATTTCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-222s1c1
Sequence:CCGGGCGATAAAGAAGAAGCAGCAACTCGAGTTGCTGCTTCTTCTTTATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-285s1c1
Sequence:CCGGGAGGTGGATATCACAATGTCACTCGAGTGACATTGTGATATCCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-4473s1c1
Sequence:CCGGCCCACCTTATTGCCTTTCCTTCTCGAGAAGGAAAGGCAATAAGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-2231s1c1
Sequence:CCGGCCAGGGACTATCCAGGAATTTCTCGAGAAATTCCTGGATAGTCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-429s1c1
Sequence:CCGGGAATCCAAGGAAAGCAACACACTCGAGTGTGTTGCTTTCCTTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-371s1c1
Sequence:CCGGCCTGCCACCTCAGATATTTAACTCGAGTTAAATATCTGAGGTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031469
VALIDATED
SH3BGRL2 MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein like 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-470s1c1
Sequence:CCGGGAAACCACGGTTGGCATCAAACTCGAGTTTGATGCCAACCGTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-370s1c1
Sequence:CCGGCCCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-215s1c1
Sequence:CCGGCTTCGTGGCGATAAAGAAGAACTCGAGTTCTTCTTTATCGCCACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-261s1c1
Sequence:CCGGGAAGCCAACAAGATAGAGTTTCTCGAGAAACTCTATCTTGTTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-237s1c1
Sequence:CCGGCAGCAAGATGTGGTTAGATTTCTCGAGAAATCTAACCACATCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-383s1c1
Sequence:CCGGGATATTTAATGGCGACCGATACTCGAGTATCGGTCGCCATTAAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031469.1-2975s1c1
Sequence:CCGGGCAAAGGAAATGTGCTGCTAACTCGAGTTAGCAGCACATTTCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-222s1c1
Sequence:CCGGGCGATAAAGAAGAAGCAGCAACTCGAGTTGCTGCTTCTTCTTTATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-285s1c1
Sequence:CCGGGAGGTGGATATCACAATGTCACTCGAGTGACATTGTGATATCCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-4473s1c1
Sequence:CCGGCCCACCTTATTGCCTTTCCTTCTCGAGAAGGAAAGGCAATAAGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-2231s1c1
Sequence:CCGGCCAGGGACTATCCAGGAATTTCTCGAGAAATTCCTGGATAGTCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-429s1c1
Sequence:CCGGGAATCCAAGGAAAGCAACACACTCGAGTGTGTTGCTTTCCTTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-371s1c1
Sequence:CCGGCCTGCCACCTCAGATATTTAACTCGAGTTAAATATCTGAGGTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031469
VALIDATED
SH3BGRL2 MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein like 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-470s1c1
Sequence:CCGGGAAACCACGGTTGGCATCAAACTCGAGTTTGATGCCAACCGTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-370s1c1
Sequence:CCGGCCCTGCCACCTCAGATATTTACTCGAGTAAATATCTGAGGTGGCAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-215s1c1
Sequence:CCGGCTTCGTGGCGATAAAGAAGAACTCGAGTTCTTCTTTATCGCCACGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-261s1c1
Sequence:CCGGGAAGCCAACAAGATAGAGTTTCTCGAGAAACTCTATCTTGTTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-237s1c1
Sequence:CCGGCAGCAAGATGTGGTTAGATTTCTCGAGAAATCTAACCACATCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-383s1c1
Sequence:CCGGGATATTTAATGGCGACCGATACTCGAGTATCGGTCGCCATTAAATATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031469.1-2975s1c1
Sequence:CCGGGCAAAGGAAATGTGCTGCTAACTCGAGTTAGCAGCACATTTCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031469.1-222s1c1
Sequence:CCGGGCGATAAAGAAGAAGCAGCAACTCGAGTTGCTGCTTCTTCTTTATCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-285s1c1
Sequence:CCGGGAGGTGGATATCACAATGTCACTCGAGTGACATTGTGATATCCACCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-4473s1c1
Sequence:CCGGCCCACCTTATTGCCTTTCCTTCTCGAGAAGGAAAGGCAATAAGGTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-2231s1c1
Sequence:CCGGCCAGGGACTATCCAGGAATTTCTCGAGAAATTCCTGGATAGTCCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-429s1c1
Sequence:CCGGGAATCCAAGGAAAGCAACACACTCGAGTGTGTTGCTTTCCTTGGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031469.1-371s1c1
Sequence:CCGGCCTGCCACCTCAGATATTTAACTCGAGTTAAATATCTGAGGTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)