EMAIL THIS PAGE TO A FRIEND

SH3BGRL3

SH3 domain binding glutamic acid-rich protein like 3

47 Gene Product Result for
Synonyms: SH3BP-1 TIP-B1
UniProtKB ID: Q9H299, Q5T122
Gene ID:
Mouse(73723) SH3 domain binding glutamic acid-rich protein-like 3
Rat(298544) SH3 domain binding glutamic acid-rich protein-like 3
naked mole-rat(101709383) SH3 domain binding glutamic acid-rich protein like 3
domestic guinea pig(100730365) SH3 domain binding glutamic acid-rich protein like 3
cow(614672) SH3 domain binding glutamic acid-rich protein like 3
sheep(101111864) SH3 domain binding glutamic acid-rich protein like 3
Zebrafish(393248) SH3 domain binding glutamic acid-rich protein like 3
chicken(768795) SH3 domain binding glutamic acid-rich protein like 3
domestic cat(101100985) SH3 domain binding glutamic acid-rich protein like 3
Horse(100146131) SH3 domain binding glutamic acid-rich protein like 3
dog(612171) SH3 domain binding glutamic acid-rich protein like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046871 MISSION® esiRNA esiRNA targeting mouse Sh3bgrl3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031286 Rosetta Predictions human pricing
NM_001106688 Rosetta Predictions rat pricing
NM_080559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190146 predicted 789
2 SASI_Hs02_00358710 predicted 540
3 SASI_Hs01_00190147 predicted 696
4 SASI_Hs01_00190148 predicted 531
5 SASI_Hs01_00190149 predicted 885
6 SASI_Hs01_00190150 predicted 573
7 SASI_Hs01_00190151 predicted 517
8 SASI_Hs02_00358711 predicted 691
9 SASI_Hs01_00190152 predicted 472
10 SASI_Hs02_00358712 predicted 764
11 SASI_Hs01_00190153 predicted 342
12 SASI_Hs01_00190154 predicted 213
13 SASI_Hs01_00190155 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221408 predicted 403
2 SASI_Rn02_00221409 predicted 455
3 SASI_Rn02_00221410 predicted 417
4 SASI_Rn02_00221411 predicted 466
5 SASI_Rn02_00221412 predicted 230
6 SASI_Rn02_00221413 predicted 216
7 SASI_Rn02_00221414 predicted 510
8 SASI_Rn02_00221415 predicted 455
9 SASI_Rn02_00221416 predicted 459
10 SASI_Rn02_00221417 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160078 predicted 375
2 SASI_Mm01_00160079 predicted 420
3 SASI_Mm01_00160080 predicted 425
4 SASI_Mm01_00160081 predicted 266
5 SASI_Mm01_00160083 predicted 434
6 SASI_Mm01_00160084 predicted 416
7 SASI_Mm01_00160085 predicted 349
8 SASI_Mm01_00160086 predicted 222
9 SASI_Mm01_00160087 predicted 220
10 SASI_Mm02_00338164 predicted 378
11 SASI_Mm01_00160082 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031286
SH3BGRL3 MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein like 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-889s21c1
Sequence:CCGGCCTCCATCTAAAGGCAACATTCTCGAGAATGTTGCCTTTAGATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-302s1c1
Sequence:CCGGCCAATACCAGCTAGTGGACATCTCGAGATGTCCACTAGCTGGTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-578s1c1
Sequence:CCGGGTCATTCCTAACCTAACCTTACTCGAGTAAGGTTAGGTTAGGAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-693s1c1
Sequence:CCGGCTCAGAAATTGTCTTAAGCAACTCGAGTTGCTTAAGACAATTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-680s1c1
Sequence:CCGGCTTACCCATTAGTCTCAGAAACTCGAGTTTCTGAGACTAATGGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-684s1c1
Sequence:CCGGCCCATTAGTCTCAGAAATTGTCTCGAGACAATTTCTGAGACTAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-303s1c1
Sequence:CCGGCAATACCAGCTAGTGGACATCCTCGAGGATGTCCACTAGCTGGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-915s21c1
Sequence:CCGGCCCATTAGTCTCAGAAATTGTCTCGAGACAATTTCTGAGACTAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-299s1c1
Sequence:CCGGCATCCAATACCAGCTAGTGGACTCGAGTCCACTAGCTGGTATTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-658s1c1
Sequence:CCGGCCTCCATCTAAAGGCAACATTCTCGAGAATGTTGCCTTTAGATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-654s1c1
Sequence:CCGGCTCTCCTCCATCTAAAGGCAACTCGAGTTGCCTTTAGATGGAGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031286.3-533s21c1
Sequence:CCGGCCAATACCAGCTAGTGGACATCTCGAGATGTCCACTAGCTGGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-924s21c1
Sequence:CCGGCTCAGAAATTGTCTTAAGCAACTCGAGTTGCTTAAGACAATTTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031286
SH3BGRL3 MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein like 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-889s21c1
Sequence:CCGGCCTCCATCTAAAGGCAACATTCTCGAGAATGTTGCCTTTAGATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-302s1c1
Sequence:CCGGCCAATACCAGCTAGTGGACATCTCGAGATGTCCACTAGCTGGTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-578s1c1
Sequence:CCGGGTCATTCCTAACCTAACCTTACTCGAGTAAGGTTAGGTTAGGAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-693s1c1
Sequence:CCGGCTCAGAAATTGTCTTAAGCAACTCGAGTTGCTTAAGACAATTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-680s1c1
Sequence:CCGGCTTACCCATTAGTCTCAGAAACTCGAGTTTCTGAGACTAATGGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-684s1c1
Sequence:CCGGCCCATTAGTCTCAGAAATTGTCTCGAGACAATTTCTGAGACTAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-303s1c1
Sequence:CCGGCAATACCAGCTAGTGGACATCCTCGAGGATGTCCACTAGCTGGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-915s21c1
Sequence:CCGGCCCATTAGTCTCAGAAATTGTCTCGAGACAATTTCTGAGACTAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-299s1c1
Sequence:CCGGCATCCAATACCAGCTAGTGGACTCGAGTCCACTAGCTGGTATTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-658s1c1
Sequence:CCGGCCTCCATCTAAAGGCAACATTCTCGAGAATGTTGCCTTTAGATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-654s1c1
Sequence:CCGGCTCTCCTCCATCTAAAGGCAACTCGAGTTGCCTTTAGATGGAGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031286.3-533s21c1
Sequence:CCGGCCAATACCAGCTAGTGGACATCTCGAGATGTCCACTAGCTGGTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-924s21c1
Sequence:CCGGCTCAGAAATTGTCTTAAGCAACTCGAGTTGCTTAAGACAATTTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031286
SH3BGRL3 MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein like 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-889s21c1
Sequence:CCGGCCTCCATCTAAAGGCAACATTCTCGAGAATGTTGCCTTTAGATGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-302s1c1
Sequence:CCGGCCAATACCAGCTAGTGGACATCTCGAGATGTCCACTAGCTGGTATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-578s1c1
Sequence:CCGGGTCATTCCTAACCTAACCTTACTCGAGTAAGGTTAGGTTAGGAATGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-693s1c1
Sequence:CCGGCTCAGAAATTGTCTTAAGCAACTCGAGTTGCTTAAGACAATTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-680s1c1
Sequence:CCGGCTTACCCATTAGTCTCAGAAACTCGAGTTTCTGAGACTAATGGGTAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-684s1c1
Sequence:CCGGCCCATTAGTCTCAGAAATTGTCTCGAGACAATTTCTGAGACTAATGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-303s1c1
Sequence:CCGGCAATACCAGCTAGTGGACATCCTCGAGGATGTCCACTAGCTGGTATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-915s21c1
Sequence:CCGGCCCATTAGTCTCAGAAATTGTCTCGAGACAATTTCTGAGACTAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-299s1c1
Sequence:CCGGCATCCAATACCAGCTAGTGGACTCGAGTCCACTAGCTGGTATTGGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-658s1c1
Sequence:CCGGCCTCCATCTAAAGGCAACATTCTCGAGAATGTTGCCTTTAGATGGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031286.2-654s1c1
Sequence:CCGGCTCTCCTCCATCTAAAGGCAACTCGAGTTGCCTTTAGATGGAGGAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031286.3-533s21c1
Sequence:CCGGCCAATACCAGCTAGTGGACATCTCGAGATGTCCACTAGCTGGTATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031286.3-924s21c1
Sequence:CCGGCTCAGAAATTGTCTTAAGCAACTCGAGTTGCTTAAGACAATTTCTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080559
VALIDATED
SH3BGRL3 MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein like 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-283s21c1
Sequence:CCGGGTCAACGGGAACCACTACTGTCTCGAGACAGTAGTGGTTCCCGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-306s21c1
Sequence:CCGGGGACTATGAACTCTTCGTGGACTCGAGTCCACGAAGAGTTCATAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080559.1-186s1c1
Sequence:CCGGGATCCAATACCAGCTAGTGGACTCGAGTCCACTAGCTGGTATTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-424s21c1
Sequence:CCGGCCAACTCCTTGTCGTCCTAATCTCGAGATTAGGACGACAAGGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-219s21c1
Sequence:CCGGCAACGCCCTTCGAGATGAGATCTCGAGATCTCATCTCGAAGGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-175s21c1
Sequence:CCGGGATGGGAAGAGGATCCAATACCTCGAGGTATTGGATCCTCTTCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080559
VALIDATED
SH3BGRL3 MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein like 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-283s21c1
Sequence:CCGGGTCAACGGGAACCACTACTGTCTCGAGACAGTAGTGGTTCCCGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-306s21c1
Sequence:CCGGGGACTATGAACTCTTCGTGGACTCGAGTCCACGAAGAGTTCATAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080559.1-186s1c1
Sequence:CCGGGATCCAATACCAGCTAGTGGACTCGAGTCCACTAGCTGGTATTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-424s21c1
Sequence:CCGGCCAACTCCTTGTCGTCCTAATCTCGAGATTAGGACGACAAGGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-219s21c1
Sequence:CCGGCAACGCCCTTCGAGATGAGATCTCGAGATCTCATCTCGAAGGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-175s21c1
Sequence:CCGGGATGGGAAGAGGATCCAATACCTCGAGGTATTGGATCCTCTTCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080559
VALIDATED
SH3BGRL3 MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein like 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-283s21c1
Sequence:CCGGGTCAACGGGAACCACTACTGTCTCGAGACAGTAGTGGTTCCCGTTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-306s21c1
Sequence:CCGGGGACTATGAACTCTTCGTGGACTCGAGTCCACGAAGAGTTCATAGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080559.1-186s1c1
Sequence:CCGGGATCCAATACCAGCTAGTGGACTCGAGTCCACTAGCTGGTATTGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-424s21c1
Sequence:CCGGCCAACTCCTTGTCGTCCTAATCTCGAGATTAGGACGACAAGGAGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-219s21c1
Sequence:CCGGCAACGCCCTTCGAGATGAGATCTCGAGATCTCATCTCGAAGGGCGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080559.1-175s21c1
Sequence:CCGGGATGGGAAGAGGATCCAATACCTCGAGGTATTGGATCCTCTTCCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)