EMAIL THIS PAGE TO A FRIEND

SH3BGRL

SH3 domain binding glutamic acid-rich protein like

91 Gene Product Result for
Synonyms: SH3BGR
UniProtKB ID: O75368, Q3SYL1, Q5JT50, Q6FIE8, Q9H0N8
Gene ID:
Mouse(56726) SH3-binding domain glutamic acid-rich protein like
Rat(302363) SH3 domain binding glutamic acid-rich protein like
cow(614007) SH3 domain binding glutamic acid-rich protein like
sheep(101120635) SH3 domain binding glutamic acid-rich protein like
chicken(422277) SH3 domain binding glutamic acid-rich protein like
domestic cat(101092420) SH3 domain binding glutamic acid-rich protein like
dog(491986) SH3 domain binding glutamic acid-rich protein like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003022 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019989 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019989 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019989 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003022 Rosetta Predictions human pricing
XM_001060518 Rosetta Predictions rat pricing
XM_217566 Rosetta Predictions rat pricing
NM_019989 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011126 predicted 850
2 SASI_Hs01_00011127 predicted 849
3 SASI_Hs01_00011129 predicted 677
4 SASI_Hs01_00011130 predicted 857
5 SASI_Hs02_00334919 predicted 751
6 SASI_Hs01_00011131 predicted 682
7 SASI_Hs01_00011132 predicted 726
8 SASI_Hs01_00011133 predicted 475
9 SASI_Hs01_00011134 predicted 424
10 SASI_Hs01_00011135 predicted 902
11 SASI_Hs01_00011128 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296792 predicted 771
2 SASI_Rn02_00296793 predicted 1193
3 SASI_Rn02_00296794 predicted 430
4 SASI_Rn02_00296795 predicted 436
5 SASI_Rn02_00296796 predicted 888
6 SASI_Rn02_00296797 predicted 351
7 SASI_Rn02_00296798 predicted 436
8 SASI_Rn02_00296799 predicted 803
9 SASI_Rn02_00296800 predicted 326
10 SASI_Rn02_00296801 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377208 predicted 767
2 SASI_Rn02_00377209 predicted 1195
3 SASI_Rn02_00377210 predicted 425
4 SASI_Rn02_00377211 predicted 441
5 SASI_Rn02_00377212 predicted 883
6 SASI_Rn02_00377213 predicted 354
7 SASI_Rn02_00377214 predicted 438
8 SASI_Rn02_00377215 predicted 807
9 SASI_Rn02_00377216 predicted 327
10 SASI_Rn02_00377217 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147292 predicted 634
2 SASI_Mm01_00147293 predicted 509
3 SASI_Mm01_00147295 predicted 995
4 SASI_Mm01_00147296 predicted 732
5 SASI_Mm01_00147297 predicted 1022
6 SASI_Mm01_00147298 predicted 1019
7 SASI_Mm01_00147299 predicted 505
8 SASI_Mm01_00147300 predicted 993
9 SASI_Mm01_00147301 predicted 830
10 SASI_Mm02_00325331 predicted 509
11 SASI_Mm01_00147294 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003022
VALIDATED
SH3BGRL MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein like
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-638s21c1
Sequence:CCGGGCCTTCTTTGAAGCCAGAGAACTCGAGTTCTCTGGCTTCAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-458s21c1
Sequence:CCGGCAAGATGTGCTTGGTTTCCTACTCGAGTAGGAAACCAAGCACATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-427s21c1
Sequence:CCGGCTCTGGCTCTACAGCGATTAACTCGAGTTAATCGCTGTAGAGCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-524s21c1
Sequence:CCGGGAAGAGAATCGGAAGTGGATGCTCGAGCATCCACTTCCGATTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-139s1c1
Sequence:CCGGCAAGATGTGCTTGGTTTCCTACTCGAGTAGGAAACCAAGCACATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-698s21c1
Sequence:CCGGCCTGGTTCAAAGGAAGCAGAACTCGAGTTCTGCTTCCTTTGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003022.1-734s1c2
Sequence:CCGGGCCATTACTATGGCAACTTAACTCGAGTTAAGTTGCCATAGTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003022.1-205s1c1
Sequence:CCGGGAAGAGAATCGGAAGTGGATGCTCGAGCATCCACTTCCGATTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-320s1c1
Sequence:CCGGCCTTCTTTGAAGCCAGAGAAACTCGAGTTTCTCTGGCTTCAAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-108s1c1
Sequence:CCGGCTCTGGCTCTACAGCGATTAACTCGAGTTAATCGCTGTAGAGCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003022.1-135s1c1
Sequence:CCGGACAACAAGATGTGCTTGGTTTCTCGAGAAACCAAGCACATCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-379s1c1
Sequence:CCGGCCTGGTTCAAAGGAAGCAGAACTCGAGTTCTGCTTCCTTTGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-319s1c1
Sequence:CCGGGCCTTCTTTGAAGCCAGAGAACTCGAGTTCTCTGGCTTCAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-734s1c1
Sequence:CCGGGCCATTACTATGGCAACTTAACTCGAGTTAAGTTGCCATAGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-1089s1c1
Sequence:CCGGCCTTGTTTAACTACACAGCTACTCGAGTAGCTGTGTAGTTAAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003022
VALIDATED
SH3BGRL MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein like
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-638s21c1
Sequence:CCGGGCCTTCTTTGAAGCCAGAGAACTCGAGTTCTCTGGCTTCAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-458s21c1
Sequence:CCGGCAAGATGTGCTTGGTTTCCTACTCGAGTAGGAAACCAAGCACATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-427s21c1
Sequence:CCGGCTCTGGCTCTACAGCGATTAACTCGAGTTAATCGCTGTAGAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-524s21c1
Sequence:CCGGGAAGAGAATCGGAAGTGGATGCTCGAGCATCCACTTCCGATTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-139s1c1
Sequence:CCGGCAAGATGTGCTTGGTTTCCTACTCGAGTAGGAAACCAAGCACATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-698s21c1
Sequence:CCGGCCTGGTTCAAAGGAAGCAGAACTCGAGTTCTGCTTCCTTTGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003022.1-734s1c2
Sequence:CCGGGCCATTACTATGGCAACTTAACTCGAGTTAAGTTGCCATAGTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003022.1-205s1c1
Sequence:CCGGGAAGAGAATCGGAAGTGGATGCTCGAGCATCCACTTCCGATTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-320s1c1
Sequence:CCGGCCTTCTTTGAAGCCAGAGAAACTCGAGTTTCTCTGGCTTCAAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-108s1c1
Sequence:CCGGCTCTGGCTCTACAGCGATTAACTCGAGTTAATCGCTGTAGAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003022.1-135s1c1
Sequence:CCGGACAACAAGATGTGCTTGGTTTCTCGAGAAACCAAGCACATCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-379s1c1
Sequence:CCGGCCTGGTTCAAAGGAAGCAGAACTCGAGTTCTGCTTCCTTTGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-319s1c1
Sequence:CCGGGCCTTCTTTGAAGCCAGAGAACTCGAGTTCTCTGGCTTCAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-734s1c1
Sequence:CCGGGCCATTACTATGGCAACTTAACTCGAGTTAAGTTGCCATAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-1089s1c1
Sequence:CCGGCCTTGTTTAACTACACAGCTACTCGAGTAGCTGTGTAGTTAAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003022
VALIDATED
SH3BGRL MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein like
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-638s21c1
Sequence:CCGGGCCTTCTTTGAAGCCAGAGAACTCGAGTTCTCTGGCTTCAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-458s21c1
Sequence:CCGGCAAGATGTGCTTGGTTTCCTACTCGAGTAGGAAACCAAGCACATCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-427s21c1
Sequence:CCGGCTCTGGCTCTACAGCGATTAACTCGAGTTAATCGCTGTAGAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-524s21c1
Sequence:CCGGGAAGAGAATCGGAAGTGGATGCTCGAGCATCCACTTCCGATTCTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-139s1c1
Sequence:CCGGCAAGATGTGCTTGGTTTCCTACTCGAGTAGGAAACCAAGCACATCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003022.2-698s21c1
Sequence:CCGGCCTGGTTCAAAGGAAGCAGAACTCGAGTTCTGCTTCCTTTGAACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003022.1-734s1c2
Sequence:CCGGGCCATTACTATGGCAACTTAACTCGAGTTAAGTTGCCATAGTAATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003022.1-205s1c1
Sequence:CCGGGAAGAGAATCGGAAGTGGATGCTCGAGCATCCACTTCCGATTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-320s1c1
Sequence:CCGGCCTTCTTTGAAGCCAGAGAAACTCGAGTTTCTCTGGCTTCAAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-108s1c1
Sequence:CCGGCTCTGGCTCTACAGCGATTAACTCGAGTTAATCGCTGTAGAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003022.1-135s1c1
Sequence:CCGGACAACAAGATGTGCTTGGTTTCTCGAGAAACCAAGCACATCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-379s1c1
Sequence:CCGGCCTGGTTCAAAGGAAGCAGAACTCGAGTTCTGCTTCCTTTGAACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-319s1c1
Sequence:CCGGGCCTTCTTTGAAGCCAGAGAACTCGAGTTCTCTGGCTTCAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-734s1c1
Sequence:CCGGGCCATTACTATGGCAACTTAACTCGAGTTAAGTTGCCATAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003022.1-1089s1c1
Sequence:CCGGCCTTGTTTAACTACACAGCTACTCGAGTAGCTGTGTAGTTAAACAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019989
VALIDATED
SH3BGRL MISSION shRNA Bacterial Glycerol Stock
SH3 domain binding glutamic acid-rich protein like
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019989.2-231s1c1
Sequence:CCGGGATTAAGAAGAAACAGCAAGACTCGAGTCTTGCTGTTTCTTCTTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019989.2-247s1c1
Sequence:CCGGCAAGATGTGCTTTGTTTCTTACTCGAGTAAGAAACAAAGCACATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-255s1c1
Sequence:CCGGGCTTTGTTTCTTAGAAGCCAACTCGAGTTGGCTTCTAAGAAACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019989.2-1266s1c1
Sequence:CCGGCCTCAGTACAATGTGGGTATACTCGAGTATACCCACATTGTACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-318s1c1
Sequence:CCGGGAATCGGAAGTGGATGAGAGACTCGAGTCTCTCATCCACTTCCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-416s21c1
Sequence:CCGGGGGATTACGATGCCTTCTTTGCTCGAGCAAAGAAGGCATCGTAATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-659s21c1
Sequence:CCGGCGCATGCAAACAAGCATAATGCTCGAGCATTATGCTTGTTTGCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-514s21c1
Sequence:CCGGGCAAATCAGCAAGCATGAATGCTCGAGCATTCATGCTTGCTGATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-216s21c1
Sequence:CCGGTTCTGGCTCTACGGCGATTAACTCGAGTTAATCGCCGTAGAGCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-477s21c1
Sequence:CCGGGACAGCACCACCTGGTTCAAACTCGAGTTTGAACCAGGTGGTGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-418s1c1
Sequence:CCGGGATTACGATGCCTTCTTTGAACTCGAGTTCAAAGAAGGCATCGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019989.2-1467s1c1
Sequence:CCGGCGTGAATGATACTGTCCTTAACTCGAGTTAAGGACAGTATCATTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019989
VALIDATED
SH3BGRL MISSION shRNA shRNA Plasmid DNA
SH3 domain binding glutamic acid-rich protein like
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019989.2-231s1c1
Sequence:CCGGGATTAAGAAGAAACAGCAAGACTCGAGTCTTGCTGTTTCTTCTTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019989.2-247s1c1
Sequence:CCGGCAAGATGTGCTTTGTTTCTTACTCGAGTAAGAAACAAAGCACATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-255s1c1
Sequence:CCGGGCTTTGTTTCTTAGAAGCCAACTCGAGTTGGCTTCTAAGAAACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019989.2-1266s1c1
Sequence:CCGGCCTCAGTACAATGTGGGTATACTCGAGTATACCCACATTGTACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-318s1c1
Sequence:CCGGGAATCGGAAGTGGATGAGAGACTCGAGTCTCTCATCCACTTCCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-416s21c1
Sequence:CCGGGGGATTACGATGCCTTCTTTGCTCGAGCAAAGAAGGCATCGTAATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-659s21c1
Sequence:CCGGCGCATGCAAACAAGCATAATGCTCGAGCATTATGCTTGTTTGCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-514s21c1
Sequence:CCGGGCAAATCAGCAAGCATGAATGCTCGAGCATTCATGCTTGCTGATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-216s21c1
Sequence:CCGGTTCTGGCTCTACGGCGATTAACTCGAGTTAATCGCCGTAGAGCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-477s21c1
Sequence:CCGGGACAGCACCACCTGGTTCAAACTCGAGTTTGAACCAGGTGGTGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-418s1c1
Sequence:CCGGGATTACGATGCCTTCTTTGAACTCGAGTTCAAAGAAGGCATCGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019989.2-1467s1c1
Sequence:CCGGCGTGAATGATACTGTCCTTAACTCGAGTTAAGGACAGTATCATTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019989
VALIDATED
SH3BGRL MISSION shRNA Lentiviral Transduction Particles
SH3 domain binding glutamic acid-rich protein like
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019989.2-231s1c1
Sequence:CCGGGATTAAGAAGAAACAGCAAGACTCGAGTCTTGCTGTTTCTTCTTAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019989.2-247s1c1
Sequence:CCGGCAAGATGTGCTTTGTTTCTTACTCGAGTAAGAAACAAAGCACATCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-255s1c1
Sequence:CCGGGCTTTGTTTCTTAGAAGCCAACTCGAGTTGGCTTCTAAGAAACAAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019989.2-1266s1c1
Sequence:CCGGCCTCAGTACAATGTGGGTATACTCGAGTATACCCACATTGTACTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-318s1c1
Sequence:CCGGGAATCGGAAGTGGATGAGAGACTCGAGTCTCTCATCCACTTCCGATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-416s21c1
Sequence:CCGGGGGATTACGATGCCTTCTTTGCTCGAGCAAAGAAGGCATCGTAATCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-659s21c1
Sequence:CCGGCGCATGCAAACAAGCATAATGCTCGAGCATTATGCTTGTTTGCATGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-514s21c1
Sequence:CCGGGCAAATCAGCAAGCATGAATGCTCGAGCATTCATGCTTGCTGATTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-216s21c1
Sequence:CCGGTTCTGGCTCTACGGCGATTAACTCGAGTTAATCGCCGTAGAGCCAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019989.2-477s21c1
Sequence:CCGGGACAGCACCACCTGGTTCAAACTCGAGTTTGAACCAGGTGGTGCTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019989.2-418s1c1
Sequence:CCGGGATTACGATGCCTTCTTTGAACTCGAGTTCAAAGAAGGCATCGTAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019989.2-1467s1c1
Sequence:CCGGCGTGAATGATACTGTCCTTAACTCGAGTTAAGGACAGTATCATTCACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)