EMAIL THIS PAGE TO A FRIEND

SH3BP1

SH3-domain binding protein 1

69 Gene Product Result for
Synonyms: ARHGAP43
UniProtKB ID: Q9Y3L3, Q5R3N0, Q6IBZ2, Q6ZVL9, Q96HQ5, Q9NSQ9
Gene ID:
Mouse(20401) SH3-domain binding protein 1
Rat(300067) SH3-domain binding protein 1
Zebrafish(100006678) SH3-domain binding protein 1
Horse(100069810) SH3-domain binding protein 1
domestic cat(101093620) SH3-domain binding protein 1
dog(481265) SH3-domain binding protein 1
chicken(430939) SH3-domain binding protein 1
cow(100297734) SH3-domain binding protein 1
sheep(101123285) SH3-domain binding protein 1
domestic guinea pig(100722080) SH3-domain binding protein 1
naked mole-rat(101719820) SH3-domain binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500938 Anti-SH3BP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2700358 Anti-SH3BP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2700525 Anti-SH3BP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018957 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018957 Rosetta Predictions human pricing
XM_001076209 Rosetta Predictions rat pricing
XM_235500 Rosetta Predictions rat pricing
NM_009164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010531 predicted 814
2 SASI_Hs02_00352430 predicted 510
3 SASI_Hs01_00010532 predicted 775
4 SASI_Hs01_00010533 predicted 738
5 SASI_Hs01_00010534 predicted 771
6 SASI_Hs01_00010536 predicted 1361
7 SASI_Hs01_00010537 predicted 985
8 SASI_Hs01_00010538 predicted 537
9 SASI_Hs01_00010539 predicted 343
10 SASI_Hs01_00010540 predicted 292
11 SASI_Hs01_00010535 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352393 predicted 1472
2 SASI_Rn02_00352394 predicted 660
3 SASI_Rn02_00352395 predicted 1405
4 SASI_Rn02_00352396 predicted 1591
5 SASI_Rn02_00352397 predicted 658
6 SASI_Rn02_00352398 predicted 853
7 SASI_Rn02_00352399 predicted 1656
8 SASI_Rn02_00352400 predicted 337
9 SASI_Rn02_00352401 predicted 1458
10 SASI_Rn02_00352402 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389389 predicted 1954
2 SASI_Rn02_00389390 predicted 1923
3 SASI_Rn02_00389391 predicted 2030
4 SASI_Rn02_00389392 predicted 2030
5 SASI_Rn02_00389393 predicted 1874
6 SASI_Rn02_00389394 predicted 2027
7 SASI_Rn02_00389395 predicted 1925
8 SASI_Rn02_00389396 predicted 1466
9 SASI_Rn02_00389397 predicted 658
10 SASI_Rn02_00389398 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175846 predicted 1600
2 SASI_Mm01_00175847 predicted 330
3 SASI_Mm01_00175848 predicted 785
4 SASI_Mm01_00175849 predicted 317
5 SASI_Mm01_00175850 predicted 1341
6 SASI_Mm01_00175851 predicted 1578
7 SASI_Mm01_00175852 predicted 955
8 SASI_Mm01_00175853 predicted 1060
9 SASI_Mm01_00175854 predicted 1190
10 SASI_Mm01_00175855 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009164
VALIDATED
SH3BP1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009164.2-1530s21c1
Sequence:CCGGAGATATCAACTTCAATGTATCCTCGAGGATACATTGAAGTTGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-663s1c1
Sequence:CCGGCTTGGAGATTCAGGCTGACTACTCGAGTAGTCAGCCTGAATCTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-627s1c1
Sequence:CCGGCAAGGAAGATTCTTATGCCAACTCGAGTTGGCATAAGAATCTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-1398s1c1
Sequence:CCGGCTTCAATGTATCAGGCATCTTCTCGAGAAGATGCCTGATACATTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.2-778s1c1
Sequence:CCGGGATTCTTATGCCAACTACTTTCTCGAGAAAGTAGTTGGCATAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009164.2-779s21c1
Sequence:CCGGATTCTTATGCCAACTACTTTACTCGAGTAAAGTAGTTGGCATAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009164.2-1069s21c1
Sequence:CCGGTCTGTGCTGAAGCGCCTTAAGCTCGAGCTTAAGGCGCTTCAGCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009164.2-242s21c1
Sequence:CCGGCTAAACGAGCAGCCCACAATGCTCGAGCATTGTGGGCTGCTCGTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009164
VALIDATED
SH3BP1 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009164.2-1530s21c1
Sequence:CCGGAGATATCAACTTCAATGTATCCTCGAGGATACATTGAAGTTGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-663s1c1
Sequence:CCGGCTTGGAGATTCAGGCTGACTACTCGAGTAGTCAGCCTGAATCTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-627s1c1
Sequence:CCGGCAAGGAAGATTCTTATGCCAACTCGAGTTGGCATAAGAATCTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-1398s1c1
Sequence:CCGGCTTCAATGTATCAGGCATCTTCTCGAGAAGATGCCTGATACATTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.2-778s1c1
Sequence:CCGGGATTCTTATGCCAACTACTTTCTCGAGAAAGTAGTTGGCATAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009164.2-779s21c1
Sequence:CCGGATTCTTATGCCAACTACTTTACTCGAGTAAAGTAGTTGGCATAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009164.2-1069s21c1
Sequence:CCGGTCTGTGCTGAAGCGCCTTAAGCTCGAGCTTAAGGCGCTTCAGCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009164.2-242s21c1
Sequence:CCGGCTAAACGAGCAGCCCACAATGCTCGAGCATTGTGGGCTGCTCGTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009164
VALIDATED
SH3BP1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009164.2-1530s21c1
Sequence:CCGGAGATATCAACTTCAATGTATCCTCGAGGATACATTGAAGTTGATATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-663s1c1
Sequence:CCGGCTTGGAGATTCAGGCTGACTACTCGAGTAGTCAGCCTGAATCTCCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-627s1c1
Sequence:CCGGCAAGGAAGATTCTTATGCCAACTCGAGTTGGCATAAGAATCTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.1-1398s1c1
Sequence:CCGGCTTCAATGTATCAGGCATCTTCTCGAGAAGATGCCTGATACATTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009164.2-778s1c1
Sequence:CCGGGATTCTTATGCCAACTACTTTCTCGAGAAAGTAGTTGGCATAAGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009164.2-779s21c1
Sequence:CCGGATTCTTATGCCAACTACTTTACTCGAGTAAAGTAGTTGGCATAAGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009164.2-1069s21c1
Sequence:CCGGTCTGTGCTGAAGCGCCTTAAGCTCGAGCTTAAGGCGCTTCAGCACAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009164.2-242s21c1
Sequence:CCGGCTAAACGAGCAGCCCACAATGCTCGAGCATTGTGGGCTGCTCGTTTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018957
SH3BP1 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-990s1c1
Sequence:CCGGCGACCTCTATGATGACTGGATCTCGAGATCCAGTCATCATAGAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-864s1c1
Sequence:CCGGGAAGCGTCTCAAGCAGACAATCTCGAGATTGTCTGCTTGAGACGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-1864s1c1
Sequence:CCGGCCAGTCTCTTTGAGTAACCCTCTCGAGAGGGTTACTCAAAGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-594s1c1
Sequence:CCGGCCTGGAGATTCAGGCCGATTACTCGAGTAATCGGCCTGAATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018957.3-348s21c1
Sequence:CCGGCACGATGGCTGAGAGCTTCAACTCGAGTTGAAGCTCTCAGCCATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018957.3-719s21c1
Sequence:CCGGAGCAATGCAGGGACGAGTACTCTCGAGAGTACTCGTCCCTGCATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018957
SH3BP1 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-990s1c1
Sequence:CCGGCGACCTCTATGATGACTGGATCTCGAGATCCAGTCATCATAGAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-864s1c1
Sequence:CCGGGAAGCGTCTCAAGCAGACAATCTCGAGATTGTCTGCTTGAGACGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-1864s1c1
Sequence:CCGGCCAGTCTCTTTGAGTAACCCTCTCGAGAGGGTTACTCAAAGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-594s1c1
Sequence:CCGGCCTGGAGATTCAGGCCGATTACTCGAGTAATCGGCCTGAATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018957.3-348s21c1
Sequence:CCGGCACGATGGCTGAGAGCTTCAACTCGAGTTGAAGCTCTCAGCCATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018957.3-719s21c1
Sequence:CCGGAGCAATGCAGGGACGAGTACTCTCGAGAGTACTCGTCCCTGCATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018957
SH3BP1 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-990s1c1
Sequence:CCGGCGACCTCTATGATGACTGGATCTCGAGATCCAGTCATCATAGAGGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-864s1c1
Sequence:CCGGGAAGCGTCTCAAGCAGACAATCTCGAGATTGTCTGCTTGAGACGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-1864s1c1
Sequence:CCGGCCAGTCTCTTTGAGTAACCCTCTCGAGAGGGTTACTCAAAGAGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018957.2-594s1c1
Sequence:CCGGCCTGGAGATTCAGGCCGATTACTCGAGTAATCGGCCTGAATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018957.3-348s21c1
Sequence:CCGGCACGATGGCTGAGAGCTTCAACTCGAGTTGAAGCTCTCAGCCATCGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018957.3-719s21c1
Sequence:CCGGAGCAATGCAGGGACGAGTACTCTCGAGAGTACTCGTCCCTGCATTGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)