EMAIL THIS PAGE TO A FRIEND

SH3BP2

SH3-domain binding protein 2

66 Gene Product Result for
Synonyms: 3BP-2 3BP2 CRBM CRPM
Gene ID:
Human(6452) Summary: The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(24055) SH3-domain binding protein 2
Rat(305450) SH3-domain binding protein 2
naked mole-rat(101701823) SH3-domain binding protein 2
Domestic Rabbit(100350793) SH3-domain binding protein 2
domestic guinea pig(100712927) SH3-domain binding protein 2
cow(617344) SH3-domain binding protein 2
sheep(101123467) SH3-domain binding protein 2
chicken(422883) SH3-domain binding protein 2
dog(488797) SH3-domain binding protein 2
Horse(100051380) SH3-domain binding protein 2
domestic cat(101097239) SH3-domain binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097341 MISSION® esiRNA esiRNA human SH3BP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122681 Rosetta Predictions human pricing
NM_003023 Rosetta Predictions human pricing
XM_001059805 Rosetta Predictions rat pricing
XM_223534 Rosetta Predictions rat pricing
NM_011893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327216 predicted 704
2 SASI_Hs02_00327217 predicted 1101
3 SASI_Hs02_00327218 predicted 1521
4 SASI_Hs02_00327219 predicted 1959
5 SASI_Hs02_00327220 predicted 1109
6 SASI_Hs02_00327221 predicted 1797
7 SASI_Hs02_00327222 predicted 1632
8 SASI_Hs02_00327223 predicted 1623
9 SASI_Hs02_00327224 predicted 1921
10 SASI_Hs02_00327225 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147642 predicted 848
2 SASI_Hs01_00147643 predicted 1246
3 SASI_Hs01_00147644 predicted 1659
4 SASI_Hs01_00147645 predicted 2101
5 SASI_Hs01_00147647 predicted 1248
6 SASI_Hs01_00147648 predicted 1933
7 SASI_Hs01_00147649 predicted 1780
8 SASI_Hs01_00147650 predicted 1763
9 SASI_Hs01_00147651 predicted 2063
10 SASI_Hs02_00334920 predicted 1765
11 SASI_Hs01_00147646 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294399 predicted 428
2 SASI_Rn02_00294400 predicted 1213
3 SASI_Rn02_00294401 predicted 615
4 SASI_Rn02_00294402 predicted 1108
5 SASI_Rn02_00294403 predicted 1502
6 SASI_Rn02_00294404 predicted 409
7 SASI_Rn02_00294405 predicted 853
8 SASI_Rn02_00294406 predicted 624
9 SASI_Rn02_00294407 predicted 649
10 SASI_Rn02_00294408 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381487 predicted 225
2 SASI_Rn02_00381488 predicted 420
3 SASI_Rn02_00381489 predicted 2328
4 SASI_Rn02_00381490 predicted 2215
5 SASI_Rn02_00381491 predicted 2174
6 SASI_Rn02_00381492 predicted 410
7 SASI_Rn02_00381493 predicted 610
8 SASI_Rn02_00381494 predicted 398
9 SASI_Rn02_00381495 predicted 2269
10 SASI_Rn02_00381496 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074430 predicted 339
2 SASI_Mm01_00074431 predicted 560
3 SASI_Mm01_00074432 predicted 953
4 SASI_Mm01_00074433 predicted 1111
5 SASI_Mm01_00074434 predicted 1564
6 SASI_Mm01_00074435 predicted 527
7 SASI_Mm01_00074436 predicted 1411
8 SASI_Mm01_00074437 predicted 1452
9 SASI_Mm01_00074438 predicted 532
10 SASI_Mm01_00074439 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003023
SH3BP2 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003023.4-1709s21c1
Sequence:CCGGGACTCTACTGCATCCGGAACTCTCGAGAGTTCCGGATGCAGTAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003023.4-2366s21c1
Sequence:CCGGGGGCTGTTGCCTCCAATAAAGCTCGAGCTTTATTGGAGGCAACAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-1773s1c1
Sequence:CCGGCTCTAACAAAGTGAGGAACTACTCGAGTAGTTCCTCACTTTGTTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-1655s1c1
Sequence:CCGGGCGAAGTGGAAAGGTTGTTCACTCGAGTGAACAACCTTTCCACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003023.4-1622s21c1
Sequence:CCGGCCAACTCGGTCTTCGTCAACACTCGAGTGTTGACGAAGACCGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003023.2-6438s1c1
Sequence:CCGGGCACCCAATTATGCAAGCATTCTCGAGAATGCTTGCATAATTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-775s1c1
Sequence:CCGGGAAGACTATGAGCACGACGATCTCGAGATCGTCGTGCTCATAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003023
SH3BP2 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003023.4-1709s21c1
Sequence:CCGGGACTCTACTGCATCCGGAACTCTCGAGAGTTCCGGATGCAGTAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003023.4-2366s21c1
Sequence:CCGGGGGCTGTTGCCTCCAATAAAGCTCGAGCTTTATTGGAGGCAACAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-1773s1c1
Sequence:CCGGCTCTAACAAAGTGAGGAACTACTCGAGTAGTTCCTCACTTTGTTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-1655s1c1
Sequence:CCGGGCGAAGTGGAAAGGTTGTTCACTCGAGTGAACAACCTTTCCACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003023.4-1622s21c1
Sequence:CCGGCCAACTCGGTCTTCGTCAACACTCGAGTGTTGACGAAGACCGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003023.2-6438s1c1
Sequence:CCGGGCACCCAATTATGCAAGCATTCTCGAGAATGCTTGCATAATTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-775s1c1
Sequence:CCGGGAAGACTATGAGCACGACGATCTCGAGATCGTCGTGCTCATAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003023
SH3BP2 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003023.4-1709s21c1
Sequence:CCGGGACTCTACTGCATCCGGAACTCTCGAGAGTTCCGGATGCAGTAGAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003023.4-2366s21c1
Sequence:CCGGGGGCTGTTGCCTCCAATAAAGCTCGAGCTTTATTGGAGGCAACAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-1773s1c1
Sequence:CCGGCTCTAACAAAGTGAGGAACTACTCGAGTAGTTCCTCACTTTGTTAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-1655s1c1
Sequence:CCGGGCGAAGTGGAAAGGTTGTTCACTCGAGTGAACAACCTTTCCACTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003023.4-1622s21c1
Sequence:CCGGCCAACTCGGTCTTCGTCAACACTCGAGTGTTGACGAAGACCGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003023.2-6438s1c1
Sequence:CCGGGCACCCAATTATGCAAGCATTCTCGAGAATGCTTGCATAATTGGGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003023.2-775s1c1
Sequence:CCGGGAAGACTATGAGCACGACGATCTCGAGATCGTCGTGCTCATAGTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011893
SH3BP2 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011893.2-2145s1c1
Sequence:CCGGGCCTCTCAATAAATCAGAGATCTCGAGATCTCTGATTTATTGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1113s1c1
Sequence:CCGGGCCTGCTAATAAGCCCAAGTTCTCGAGAACTTGGGCTTATTAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1575s1c1
Sequence:CCGGAGTGAGGAATTATCGCATCTTCTCGAGAAGATGCGATAATTCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1576s1c1
Sequence:CCGGGTGAGGAATTATCGCATCTTTCTCGAGAAAGATGCGATAATTCCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-342s1c1
Sequence:CCGGCCCATTCAAGATCATTCACATCTCGAGATGTGAATGATCTTGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011893
SH3BP2 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011893.2-2145s1c1
Sequence:CCGGGCCTCTCAATAAATCAGAGATCTCGAGATCTCTGATTTATTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1113s1c1
Sequence:CCGGGCCTGCTAATAAGCCCAAGTTCTCGAGAACTTGGGCTTATTAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1575s1c1
Sequence:CCGGAGTGAGGAATTATCGCATCTTCTCGAGAAGATGCGATAATTCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1576s1c1
Sequence:CCGGGTGAGGAATTATCGCATCTTTCTCGAGAAAGATGCGATAATTCCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-342s1c1
Sequence:CCGGCCCATTCAAGATCATTCACATCTCGAGATGTGAATGATCTTGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011893
SH3BP2 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011893.2-2145s1c1
Sequence:CCGGGCCTCTCAATAAATCAGAGATCTCGAGATCTCTGATTTATTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1113s1c1
Sequence:CCGGGCCTGCTAATAAGCCCAAGTTCTCGAGAACTTGGGCTTATTAGCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1575s1c1
Sequence:CCGGAGTGAGGAATTATCGCATCTTCTCGAGAAGATGCGATAATTCCTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-1576s1c1
Sequence:CCGGGTGAGGAATTATCGCATCTTTCTCGAGAAAGATGCGATAATTCCTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011893.2-342s1c1
Sequence:CCGGCCCATTCAAGATCATTCACATCTCGAGATGTGAATGATCTTGAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)