EMAIL THIS PAGE TO A FRIEND

SH3BP4

SH3-domain binding protein 4

82 Gene Product Result for
Synonyms: BOG25 TTP
UniProtKB ID: Q9P0V3, O95082, Q309A3, Q53QD0, Q53TD1
Gene ID:
Human(23677) Summary: This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Mouse(98402) SH3-domain binding protein 4
Rat(64634) SH3-domain binding protein 4
Zebrafish(569399) SH3-domain binding protein 4
Horse(100065797) SH3-domain binding protein 4
domestic cat(101080316) SH3-domain binding protein 4
dog(486172) SH3-domain binding protein 4
chicken(424027) SH3-domain binding protein 4
cow(520462) SH3-domain binding protein 4
sheep(101104281) SH3-domain binding protein 4
domestic guinea pig(100730563) SH3-domain binding protein 4
Domestic Rabbit(100347097) SH3-domain binding protein 4
naked mole-rat(101712966) SH3-domain binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014521 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061651 MISSION® esiRNA esiRNA human SH3BP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014521 Rosetta Predictions human pricing
NM_022693 Rosetta Predictions rat pricing
NM_133816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175870 predicted 1561
2 SASI_Hs01_00175871 predicted 555
3 SASI_Hs01_00175872 predicted 1819
4 SASI_Hs01_00175873 predicted 858
5 SASI_Hs01_00175874 predicted 1571
6 SASI_Hs02_00345806 predicted 562
7 SASI_Hs01_00175876 predicted 597
8 SASI_Hs01_00175877 predicted 1996
9 SASI_Hs01_00175878 predicted 1558
10 SASI_Hs01_00175879 predicted 546
11 SASI_Hs01_00175875 predicted 2260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263485 predicted 2778
2 SASI_Rn01_00119712 predicted 2444
3 SASI_Rn01_00119713 predicted 559
4 SASI_Rn01_00119714 predicted 2171
5 SASI_Rn01_00119715 predicted 2263
6 SASI_Rn01_00119716 predicted 2758
7 SASI_Rn01_00119717 predicted 206
8 SASI_Rn01_00119718 predicted 971
9 SASI_Rn01_00119720 predicted 1737
10 SASI_Rn01_00119721 predicted 221
11 SASI_Rn01_00119719 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050791 predicted 1493
2 SASI_Mm01_00050792 predicted 433
3 SASI_Mm01_00050793 predicted 2006
4 SASI_Mm01_00050794 predicted 1765
5 SASI_Mm01_00050795 predicted 1283
6 SASI_Mm01_00050796 predicted 800
7 SASI_Mm01_00050797 predicted 1059
8 SASI_Mm01_00050798 predicted 1911
9 SASI_Mm01_00050799 predicted 530
10 SASI_Mm01_00050800 predicted 2768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014521
VALIDATED
SH3BP4 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-487s1c1
Sequence:CCGGCCACACCTTTCGGAAATGCAACTCGAGTTGCATTTCCGAAAGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-1124s1c1
Sequence:CCGGGAGTTTCTTCACCGGCTTGAACTCGAGTTCAAGCCGGTGAAGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014521.2-545s21c1
Sequence:CCGGCCACACCTTTCGGAAATGCAACTCGAGTTGCATTTCCGAAAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014521.2-3783s21c1
Sequence:GTACCGGCTTTCACTCCCTGCGTGTAAGCTCGAGCTTACACGCAGGGAGTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-2847s1c1
Sequence:CCGGGTCAGACTCATCCAGGACTTTCTCGAGAAAGTCCTGGATGAGTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-1730s1c1
Sequence:CCGGCGTGTGGGACTTCATCAATAACTCGAGTTATTGATGAAGTCCCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-1517s1c1
Sequence:CCGGGATGAAAGTGTCAGCCGAGATCTCGAGATCTCGGCTGACACTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014521.2-3566s21c1
Sequence:GTACCGGATGAGAAAGGTGGTATCTAATCTCGAGATTAGATACCACCTTTCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-488s1c1
Sequence:CCGGCACACCTTTCGGAAATGCAAACTCGAGTTTGCATTTCCGAAAGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014521.2-1575s21c1
Sequence:CCGGGATGAAAGTGTCAGCCGAGATCTCGAGATCTCGGCTGACACTTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014521.2-1182s21c1
Sequence:CCGGGAGTTTCTTCACCGGCTTGAACTCGAGTTCAAGCCGGTGAAGAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014521.2-2905s21c1
Sequence:CCGGGTCAGACTCATCCAGGACTTTCTCGAGAAAGTCCTGGATGAGTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014521
VALIDATED
SH3BP4 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-487s1c1
Sequence:CCGGCCACACCTTTCGGAAATGCAACTCGAGTTGCATTTCCGAAAGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-1124s1c1
Sequence:CCGGGAGTTTCTTCACCGGCTTGAACTCGAGTTCAAGCCGGTGAAGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014521.2-545s21c1
Sequence:CCGGCCACACCTTTCGGAAATGCAACTCGAGTTGCATTTCCGAAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014521.2-3783s21c1
Sequence:GTACCGGCTTTCACTCCCTGCGTGTAAGCTCGAGCTTACACGCAGGGAGTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-2847s1c1
Sequence:CCGGGTCAGACTCATCCAGGACTTTCTCGAGAAAGTCCTGGATGAGTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-1730s1c1
Sequence:CCGGCGTGTGGGACTTCATCAATAACTCGAGTTATTGATGAAGTCCCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-1517s1c1
Sequence:CCGGGATGAAAGTGTCAGCCGAGATCTCGAGATCTCGGCTGACACTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014521.2-3566s21c1
Sequence:GTACCGGATGAGAAAGGTGGTATCTAATCTCGAGATTAGATACCACCTTTCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-488s1c1
Sequence:CCGGCACACCTTTCGGAAATGCAAACTCGAGTTTGCATTTCCGAAAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014521.2-1575s21c1
Sequence:CCGGGATGAAAGTGTCAGCCGAGATCTCGAGATCTCGGCTGACACTTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014521.2-1182s21c1
Sequence:CCGGGAGTTTCTTCACCGGCTTGAACTCGAGTTCAAGCCGGTGAAGAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014521.2-2905s21c1
Sequence:CCGGGTCAGACTCATCCAGGACTTTCTCGAGAAAGTCCTGGATGAGTCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014521
VALIDATED
SH3BP4 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-487s1c1
Sequence:CCGGCCACACCTTTCGGAAATGCAACTCGAGTTGCATTTCCGAAAGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-1124s1c1
Sequence:CCGGGAGTTTCTTCACCGGCTTGAACTCGAGTTCAAGCCGGTGAAGAAACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014521.2-545s21c1
Sequence:CCGGCCACACCTTTCGGAAATGCAACTCGAGTTGCATTTCCGAAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014521.2-3783s21c1
Sequence:GTACCGGCTTTCACTCCCTGCGTGTAAGCTCGAGCTTACACGCAGGGAGTGAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-2847s1c1
Sequence:CCGGGTCAGACTCATCCAGGACTTTCTCGAGAAAGTCCTGGATGAGTCTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-1730s1c1
Sequence:CCGGCGTGTGGGACTTCATCAATAACTCGAGTTATTGATGAAGTCCCACACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014521.1-1517s1c1
Sequence:CCGGGATGAAAGTGTCAGCCGAGATCTCGAGATCTCGGCTGACACTTTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014521.2-3566s21c1
Sequence:GTACCGGATGAGAAAGGTGGTATCTAATCTCGAGATTAGATACCACCTTTCTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014521.1-488s1c1
Sequence:CCGGCACACCTTTCGGAAATGCAAACTCGAGTTTGCATTTCCGAAAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014521.2-1575s21c1
Sequence:CCGGGATGAAAGTGTCAGCCGAGATCTCGAGATCTCGGCTGACACTTTCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014521.2-1182s21c1
Sequence:CCGGGAGTTTCTTCACCGGCTTGAACTCGAGTTCAAGCCGGTGAAGAAACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014521.2-2905s21c1
Sequence:CCGGGTCAGACTCATCCAGGACTTTCTCGAGAAAGTCCTGGATGAGTCTGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133816
VALIDATED
SH3BP4 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-669s1c1
Sequence:CCGGGCAGCCATTAAACTACCGGAACTCGAGTTCCGGTAGTTTAATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-807s1c1
Sequence:CCGGGCCCTATAGTAACAACCCTTTCTCGAGAAAGGGTTGTTACTATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-1950s1c1
Sequence:CCGGCAGAGTGTGTATGTTCTCCAACTCGAGTTGGAGAACATACACACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-1733s1c1
Sequence:CCGGCCGTGTGGGATTTCATCAATACTCGAGTATTGATGAAATCCCACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133816.1-3507s1c1
Sequence:CCGGGCCAATTGTGTTGCTTTCTATCTCGAGATAGAAAGCAACACAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133816.2-1960s21c1
Sequence:CCGGATGTTCTCCAATATGACTAACCTCGAGGTTAGTCATATTGGAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133816.2-807s21c1
Sequence:CCGGGCCCTATAGTAACAACCCTTTCTCGAGAAAGGGTTGTTACTATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133816.2-3507s21c1
Sequence:CCGGGCCAATTGTGTTGCTTTCTATCTCGAGATAGAAAGCAACACAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133816.2-660s21c1
Sequence:CCGGCTCCTACGTGCAGCCATTAAACTCGAGTTTAATGGCTGCACGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133816.2-874s21c1
Sequence:CCGGCCCAGTACGGATGAGCTAAACCTCGAGGTTTAGCTCATCCGTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133816
VALIDATED
SH3BP4 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-669s1c1
Sequence:CCGGGCAGCCATTAAACTACCGGAACTCGAGTTCCGGTAGTTTAATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-807s1c1
Sequence:CCGGGCCCTATAGTAACAACCCTTTCTCGAGAAAGGGTTGTTACTATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-1950s1c1
Sequence:CCGGCAGAGTGTGTATGTTCTCCAACTCGAGTTGGAGAACATACACACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-1733s1c1
Sequence:CCGGCCGTGTGGGATTTCATCAATACTCGAGTATTGATGAAATCCCACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133816.1-3507s1c1
Sequence:CCGGGCCAATTGTGTTGCTTTCTATCTCGAGATAGAAAGCAACACAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133816.2-1960s21c1
Sequence:CCGGATGTTCTCCAATATGACTAACCTCGAGGTTAGTCATATTGGAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133816.2-807s21c1
Sequence:CCGGGCCCTATAGTAACAACCCTTTCTCGAGAAAGGGTTGTTACTATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133816.2-3507s21c1
Sequence:CCGGGCCAATTGTGTTGCTTTCTATCTCGAGATAGAAAGCAACACAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133816.2-660s21c1
Sequence:CCGGCTCCTACGTGCAGCCATTAAACTCGAGTTTAATGGCTGCACGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133816.2-874s21c1
Sequence:CCGGCCCAGTACGGATGAGCTAAACCTCGAGGTTTAGCTCATCCGTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133816
VALIDATED
SH3BP4 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-669s1c1
Sequence:CCGGGCAGCCATTAAACTACCGGAACTCGAGTTCCGGTAGTTTAATGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-807s1c1
Sequence:CCGGGCCCTATAGTAACAACCCTTTCTCGAGAAAGGGTTGTTACTATAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-1950s1c1
Sequence:CCGGCAGAGTGTGTATGTTCTCCAACTCGAGTTGGAGAACATACACACTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133816.1-1733s1c1
Sequence:CCGGCCGTGTGGGATTTCATCAATACTCGAGTATTGATGAAATCCCACACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133816.1-3507s1c1
Sequence:CCGGGCCAATTGTGTTGCTTTCTATCTCGAGATAGAAAGCAACACAATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133816.2-1960s21c1
Sequence:CCGGATGTTCTCCAATATGACTAACCTCGAGGTTAGTCATATTGGAGAACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133816.2-807s21c1
Sequence:CCGGGCCCTATAGTAACAACCCTTTCTCGAGAAAGGGTTGTTACTATAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133816.2-3507s21c1
Sequence:CCGGGCCAATTGTGTTGCTTTCTATCTCGAGATAGAAAGCAACACAATTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133816.2-660s21c1
Sequence:CCGGCTCCTACGTGCAGCCATTAAACTCGAGTTTAATGGCTGCACGTAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133816.2-874s21c1
Sequence:CCGGCCCAGTACGGATGAGCTAAACCTCGAGGTTTAGCTCATCCGTACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)