EMAIL THIS PAGE TO A FRIEND

SH3BP5

SH3-domain binding protein 5 (BTK-associated)

73 Gene Product Result for
Synonyms: SAB SH3BP-5
UniProtKB ID: O60239, B3KQW6, Q5JWV9
Gene ID:
Mouse(24056) SH3-domain binding protein 5 (BTK-associated)
Rat(117186) SH3-domain binding protein 5 (BTK-associated)
chicken(420682) SH3-domain binding protein 5 (BTK-associated)
domestic cat(101092392) SH3-domain binding protein 5 (BTK-associated)
Horse(100064052) SH3-domain binding protein 5 (BTK-associated)
dog(485657) SH3-domain binding protein 5 (BTK-associated)
naked mole-rat(101704525) SH3-domain binding protein 5 (BTK-associated)
domestic guinea pig(100729876) SH3-domain binding protein 5 (BTK-associated)
cow(618056) SH3-domain binding protein 5 (BTK-associated)
sheep(101112449) SH3-domain binding protein 5 (BTK-associated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018009 Rosetta Predictions human pricing
NM_004844 Rosetta Predictions human pricing
NM_054011 Rosetta Predictions rat pricing
NM_011894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044475 predicted 1608
2 SASI_Hs01_00044476 predicted 1696
3 SASI_Hs01_00044479 predicted 1719
4 SASI_Hs01_00044480 predicted 1590
5 SASI_Hs02_00306900 predicted 781
6 SASI_Hs01_00044481 predicted 1675
7 SASI_Hs01_00044482 predicted 1029
8 SASI_Hs01_00044483 predicted 822
9 SASI_Hs02_00306901 predicted 1019
10 SASI_Hs02_00306902 predicted 1563
11 SASI_Hs01_00044477 predicted 1585
12 SASI_Hs01_00044478 predicted 1715
13 SASI_Hs01_00044484 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106093 predicted 1778
2 SASI_Hs01_00106096 predicted 1806
3 SASI_Hs01_00106097 predicted 1674
4 SASI_Hs02_00338428 predicted 873
5 SASI_Hs01_00106098 predicted 1755
6 SASI_Hs01_00106099 predicted 1119
7 SASI_Hs01_00106100 predicted 909
8 SASI_Hs02_00338429 predicted 1105
9 SASI_Hs02_00338430 predicted 1656
10 SASI_Hs02_00338431 predicted 682
11 SASI_Hs01_00106092 predicted 1701
12 SASI_Hs01_00106094 predicted 1670
13 SASI_Hs01_00106095 predicted 1804
14 SASI_Hs01_00106101 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056914 predicted 1425
2 SASI_Rn01_00056915 predicted 1453
3 SASI_Rn01_00056916 predicted 1437
4 SASI_Rn01_00056917 predicted 1436
5 SASI_Rn01_00056918 predicted 1395
6 SASI_Rn01_00056919 predicted 1424
7 SASI_Rn01_00056920 predicted 1327
8 SASI_Rn01_00056921 predicted 642
9 SASI_Rn01_00056922 predicted 1452
10 SASI_Rn01_00056923 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031263 predicted 960
2 SASI_Mm01_00031264 predicted 1476
3 SASI_Mm01_00031265 predicted 1513
4 SASI_Mm02_00321703 predicted 1463
5 SASI_Mm01_00031267 predicted 1502
6 SASI_Mm01_00031268 predicted 1500
7 SASI_Mm01_00031269 predicted 1263
8 SASI_Mm01_00031270 predicted 1286
9 SASI_Mm01_00031271 predicted 1169
10 SASI_Mm02_00321704 predicted 592
11 SASI_Mm01_00031266 predicted 725
12 SASI_Mm01_00031272 predicted 1221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004844
VALIDATED
SH3BP5 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 5 (BTK-associated)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-1251s21c1
Sequence:CCGGCCTGTCAGAGTTTGGGATGATCTCGAGATCATCCCAAACTCTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-410s21c1
Sequence:CCGGGCTCTGTTCTGGTTGAAGCAACTCGAGTTGCTTCAACCAGAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-778s21c1
Sequence:CCGGCTGGAGAAGAAACTCAAGAGACTCGAGTCTCTTGAGTTTCTTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-427s21c1
Sequence:CCGGGCAACGGTGAAACTGGATGAACTCGAGTTCATCCAGTTTCACCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-249s1c1
Sequence:CCGGCAAAGCTGTGGAAGACTCCAACTCGAGTTGGAGTCTTCCACAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-562s1c1
Sequence:CCGGCTGGAGAAGAAACTCAAGAGACTCGAGTCTCTTGAGTTTCTTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-325s21c1
Sequence:CCGGCAGGGAGAACTGGAGAAGTTACTCGAGTAACTTCTCCAGTTCTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-211s1c1
Sequence:CCGGGCAACGGTGAAACTGGATGAACTCGAGTTCATCCAGTTTCACCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-938s1c1
Sequence:CCGGCCAGCTTTAGTTCAGGACCAACTCGAGTTGGTCCTGAACTAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-585s1c1
Sequence:CCGGCATCAACAAGTCCAAGCCTTACTCGAGTAAGGCTTGGACTTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-875s1c1
Sequence:CCGGCCTTTGAAGATGACAGCTGTACTCGAGTACAGCTGTCATCTTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-194s1c1
Sequence:CCGGGCTCTGTTCTGGTTGAAGCAACTCGAGTTGCTTCAACCAGAACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-696s1c1
Sequence:CCGGCGAGTACAAGATGGCCCTGAACTCGAGTTCAGGGCCATCTTGTACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-202s1c1
Sequence:CCGGCTGGTTGAAGCAACGGTGAAACTCGAGTTTCACCGTTGCTTCAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-109s1c1
Sequence:CCGGCAGGGAGAACTGGAGAAGTTACTCGAGTAACTTCTCCAGTTCTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-729s1c1
Sequence:CCGGGATCTCAGATGAGATCCACGACTCGAGTCGTGGATCTCATCTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-1035s1c1
Sequence:CCGGCCTGTCAGAGTTTGGGATGATCTCGAGATCATCCCAAACTCTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004844
VALIDATED
SH3BP5 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 5 (BTK-associated)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-1251s21c1
Sequence:CCGGCCTGTCAGAGTTTGGGATGATCTCGAGATCATCCCAAACTCTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-410s21c1
Sequence:CCGGGCTCTGTTCTGGTTGAAGCAACTCGAGTTGCTTCAACCAGAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-778s21c1
Sequence:CCGGCTGGAGAAGAAACTCAAGAGACTCGAGTCTCTTGAGTTTCTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-427s21c1
Sequence:CCGGGCAACGGTGAAACTGGATGAACTCGAGTTCATCCAGTTTCACCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-249s1c1
Sequence:CCGGCAAAGCTGTGGAAGACTCCAACTCGAGTTGGAGTCTTCCACAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-562s1c1
Sequence:CCGGCTGGAGAAGAAACTCAAGAGACTCGAGTCTCTTGAGTTTCTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-325s21c1
Sequence:CCGGCAGGGAGAACTGGAGAAGTTACTCGAGTAACTTCTCCAGTTCTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-211s1c1
Sequence:CCGGGCAACGGTGAAACTGGATGAACTCGAGTTCATCCAGTTTCACCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-938s1c1
Sequence:CCGGCCAGCTTTAGTTCAGGACCAACTCGAGTTGGTCCTGAACTAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-585s1c1
Sequence:CCGGCATCAACAAGTCCAAGCCTTACTCGAGTAAGGCTTGGACTTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-875s1c1
Sequence:CCGGCCTTTGAAGATGACAGCTGTACTCGAGTACAGCTGTCATCTTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-194s1c1
Sequence:CCGGGCTCTGTTCTGGTTGAAGCAACTCGAGTTGCTTCAACCAGAACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-696s1c1
Sequence:CCGGCGAGTACAAGATGGCCCTGAACTCGAGTTCAGGGCCATCTTGTACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-202s1c1
Sequence:CCGGCTGGTTGAAGCAACGGTGAAACTCGAGTTTCACCGTTGCTTCAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-109s1c1
Sequence:CCGGCAGGGAGAACTGGAGAAGTTACTCGAGTAACTTCTCCAGTTCTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-729s1c1
Sequence:CCGGGATCTCAGATGAGATCCACGACTCGAGTCGTGGATCTCATCTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-1035s1c1
Sequence:CCGGCCTGTCAGAGTTTGGGATGATCTCGAGATCATCCCAAACTCTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004844
VALIDATED
SH3BP5 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 5 (BTK-associated)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-1251s21c1
Sequence:CCGGCCTGTCAGAGTTTGGGATGATCTCGAGATCATCCCAAACTCTGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-410s21c1
Sequence:CCGGGCTCTGTTCTGGTTGAAGCAACTCGAGTTGCTTCAACCAGAACAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-778s21c1
Sequence:CCGGCTGGAGAAGAAACTCAAGAGACTCGAGTCTCTTGAGTTTCTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-427s21c1
Sequence:CCGGGCAACGGTGAAACTGGATGAACTCGAGTTCATCCAGTTTCACCGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-249s1c1
Sequence:CCGGCAAAGCTGTGGAAGACTCCAACTCGAGTTGGAGTCTTCCACAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-562s1c1
Sequence:CCGGCTGGAGAAGAAACTCAAGAGACTCGAGTCTCTTGAGTTTCTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004844.3-325s21c1
Sequence:CCGGCAGGGAGAACTGGAGAAGTTACTCGAGTAACTTCTCCAGTTCTCCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-211s1c1
Sequence:CCGGGCAACGGTGAAACTGGATGAACTCGAGTTCATCCAGTTTCACCGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-938s1c1
Sequence:CCGGCCAGCTTTAGTTCAGGACCAACTCGAGTTGGTCCTGAACTAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-585s1c1
Sequence:CCGGCATCAACAAGTCCAAGCCTTACTCGAGTAAGGCTTGGACTTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-875s1c1
Sequence:CCGGCCTTTGAAGATGACAGCTGTACTCGAGTACAGCTGTCATCTTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-194s1c1
Sequence:CCGGGCTCTGTTCTGGTTGAAGCAACTCGAGTTGCTTCAACCAGAACAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-696s1c1
Sequence:CCGGCGAGTACAAGATGGCCCTGAACTCGAGTTCAGGGCCATCTTGTACTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-202s1c1
Sequence:CCGGCTGGTTGAAGCAACGGTGAAACTCGAGTTTCACCGTTGCTTCAACCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-109s1c1
Sequence:CCGGCAGGGAGAACTGGAGAAGTTACTCGAGTAACTTCTCCAGTTCTCCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004844.1-729s1c1
Sequence:CCGGGATCTCAGATGAGATCCACGACTCGAGTCGTGGATCTCATCTGAGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004844.1-1035s1c1
Sequence:CCGGCCTGTCAGAGTTTGGGATGATCTCGAGATCATCCCAAACTCTGACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011894
VALIDATED
SH3BP5 MISSION shRNA Bacterial Glycerol Stock
SH3-domain binding protein 5 (BTK-associated)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1471s21c1
Sequence:CCGGGCCTATGTGCAGATCATATTTCTCGAGAAATATGATCTGCACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011894.1-151s1c1
Sequence:CCGGGCAACGGTGAAACTAGACGAACTCGAGTTCGTCTAGTTTCACCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011894.1-524s1c1
Sequence:CCGGCCATCAACAAGTCCAAGCCTTCTCGAGAAGGCTTGGACTTGTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011894.1-1098s1c1
Sequence:CCGGGAGTGACAAAGCCAACAACAACTCGAGTTGTTGTTGGCTTTGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1066s21c1
Sequence:CCGGACCGACGAGTCCGTCTGAAATCTCGAGATTTCAGACGGACTCGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-519s21c1
Sequence:CCGGAGGATGACAAGCGGCAGTTTGCTCGAGCAAACTGCCGCTTGTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011894.2-2282s1c1
Sequence:CCGGGTTTATGCTGCACCTAGTATTCTCGAGAATACTAGGTGCAGCATAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1413s21c1
Sequence:CCGGATGGAATTATTGCTGACATAACTCGAGTTATGTCAGCAATAATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1038s21c1
Sequence:CCGGCCCAGTCTGTGTCCAGCTTTACTCGAGTAAAGCTGGACACAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011894
VALIDATED
SH3BP5 MISSION shRNA shRNA Plasmid DNA
SH3-domain binding protein 5 (BTK-associated)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1471s21c1
Sequence:CCGGGCCTATGTGCAGATCATATTTCTCGAGAAATATGATCTGCACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011894.1-151s1c1
Sequence:CCGGGCAACGGTGAAACTAGACGAACTCGAGTTCGTCTAGTTTCACCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011894.1-524s1c1
Sequence:CCGGCCATCAACAAGTCCAAGCCTTCTCGAGAAGGCTTGGACTTGTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011894.1-1098s1c1
Sequence:CCGGGAGTGACAAAGCCAACAACAACTCGAGTTGTTGTTGGCTTTGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1066s21c1
Sequence:CCGGACCGACGAGTCCGTCTGAAATCTCGAGATTTCAGACGGACTCGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-519s21c1
Sequence:CCGGAGGATGACAAGCGGCAGTTTGCTCGAGCAAACTGCCGCTTGTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011894.2-2282s1c1
Sequence:CCGGGTTTATGCTGCACCTAGTATTCTCGAGAATACTAGGTGCAGCATAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1413s21c1
Sequence:CCGGATGGAATTATTGCTGACATAACTCGAGTTATGTCAGCAATAATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1038s21c1
Sequence:CCGGCCCAGTCTGTGTCCAGCTTTACTCGAGTAAAGCTGGACACAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011894
VALIDATED
SH3BP5 MISSION shRNA Lentiviral Transduction Particles
SH3-domain binding protein 5 (BTK-associated)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1471s21c1
Sequence:CCGGGCCTATGTGCAGATCATATTTCTCGAGAAATATGATCTGCACATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011894.1-151s1c1
Sequence:CCGGGCAACGGTGAAACTAGACGAACTCGAGTTCGTCTAGTTTCACCGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011894.1-524s1c1
Sequence:CCGGCCATCAACAAGTCCAAGCCTTCTCGAGAAGGCTTGGACTTGTTGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011894.1-1098s1c1
Sequence:CCGGGAGTGACAAAGCCAACAACAACTCGAGTTGTTGTTGGCTTTGTCACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1066s21c1
Sequence:CCGGACCGACGAGTCCGTCTGAAATCTCGAGATTTCAGACGGACTCGTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-519s21c1
Sequence:CCGGAGGATGACAAGCGGCAGTTTGCTCGAGCAAACTGCCGCTTGTCATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011894.2-2282s1c1
Sequence:CCGGGTTTATGCTGCACCTAGTATTCTCGAGAATACTAGGTGCAGCATAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1413s21c1
Sequence:CCGGATGGAATTATTGCTGACATAACTCGAGTTATGTCAGCAATAATTCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011894.2-1038s21c1
Sequence:CCGGCCCAGTCTGTGTCCAGCTTTACTCGAGTAAAGCTGGACACAGACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)