EMAIL THIS PAGE TO A FRIEND

SH3BP5L

SH3-binding domain protein 5-like

63 Gene Product Result for
UniProtKB ID: Q7L8J4, Q96FI5, Q9BQH8, Q9C0E3
Gene ID:
Mouse(79566) SH3 binding domain protein 5 like
Rat(690898) SH3 binding domain protein 5 like
domestic cat(101081517) SH3-binding domain protein 5-like
Horse(100049828) SH3-binding domain protein 5-like
dog(482700) SH3-binding domain protein 5-like
cow(520254) SH3-binding domain protein 5-like
sheep(101112393) SH3-binding domain protein 5-like
domestic guinea pig(100733851) SH3-binding domain protein 5-like
naked mole-rat(101723190) SH3-binding domain protein 5-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030645 Rosetta Predictions human pricing
NM_001127581 Rosetta Predictions rat pricing
NM_024480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182464 predicted 829
2 SASI_Hs01_00182465 predicted 1741
3 SASI_Hs01_00182466 predicted 1130
4 SASI_Hs01_00182468 predicted 980
5 SASI_Hs01_00182469 predicted 1916
6 SASI_Hs01_00182470 predicted 2079
7 SASI_Hs01_00182471 predicted 977
8 SASI_Hs01_00182472 predicted 808
9 SASI_Hs02_00358221 predicted 1053
10 SASI_Hs02_00358222 predicted 877
11 SASI_Hs01_00182463 predicted 1079
12 SASI_Hs01_00182467 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254540 predicted 1884
2 SASI_Rn02_00254541 predicted 1521
3 SASI_Rn02_00254542 predicted 1610
4 SASI_Rn02_00254543 predicted 1134
5 SASI_Rn02_00254544 predicted 1134
6 SASI_Rn02_00254545 predicted 964
7 SASI_Rn02_00254546 predicted 1994
8 SASI_Rn02_00254547 predicted 722
9 SASI_Rn02_00254548 predicted 785
10 SASI_Rn02_00254549 predicted 1950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171559 predicted 1894
2 SASI_Mm01_00171560 predicted 1469
3 SASI_Mm01_00171561 predicted 2004
4 SASI_Mm01_00171562 predicted 1449
5 SASI_Mm01_00171563 predicted 1836
6 SASI_Mm01_00171564 predicted 1489
7 SASI_Mm02_00327862 predicted 1949
8 SASI_Mm01_00171566 predicted 854
9 SASI_Mm01_00171567 predicted 965
10 SASI_Mm01_00171568 predicted 1356
11 SASI_Mm01_00171565 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024480
VALIDATED
SH3BP5L MISSION shRNA Bacterial Glycerol Stock
SH3-binding domain protein 5-like
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024480.2-2255s1c1
Sequence:CCGGCCTGTTATCAACACAGGCATTCTCGAGAATGCCTGTGTTGATAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024480.2-690s1c1
Sequence:CCGGGAAATCAACCAGGTGGAGCTACTCGAGTAGCTCCACCTGGTTGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024480.2-1450s1c1
Sequence:CCGGGCCCAGATACGGACACGCTAACTCGAGTTAGCGTGTCCGTATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024480.2-995s1c1
Sequence:CCGGCCATGCTACCTGTAAGGTGAACTCGAGTTCACCTTACAGGTAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-782s21c1
Sequence:CCGGGAGTCAGCCAGGAAGCTTAACCTCGAGGTTAAGCTTCCTGGCTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024480.2-1253s1c1
Sequence:CCGGCCTGCGTAATCTGGAGCAGATCTCGAGATCTGCTCCAGATTACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-1019s21c1
Sequence:CCGGCTCAACCATGCTACCTGTAAGCTCGAGCTTACAGGTAGCATGGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-1485s21c1
Sequence:CCGGATACGGACACGCTAAGCTTATCTCGAGATAAGCTTAGCGTGTCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024480.4-2056s21c1
Sequence:CCGGCAGGCTTTCACCCGTTGATTCCTCGAGGAATCAACGGGTGAAAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.3-635s21c1
Sequence:CCGGGAACTGGATCCTAGGATACAGCTCGAGCTGTATCCTAGGATCCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024480.3-2062s21c1
Sequence:CCGGCAGAAGGCGTGCCCTAGATATCTCGAGATATCTAGGGCACGCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.3-1149s21c1
Sequence:CCGGTTGAGCTCAAGGCCCAGTTCACTCGAGTGAACTGGGCCTTGAGCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-625s21c1
Sequence:CCGGCAACAGCAGTGAGACCAAATTCTCGAGAATTTGGTCTCACTGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024480
VALIDATED
SH3BP5L MISSION shRNA shRNA Plasmid DNA
SH3-binding domain protein 5-like
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024480.2-2255s1c1
Sequence:CCGGCCTGTTATCAACACAGGCATTCTCGAGAATGCCTGTGTTGATAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024480.2-690s1c1
Sequence:CCGGGAAATCAACCAGGTGGAGCTACTCGAGTAGCTCCACCTGGTTGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024480.2-1450s1c1
Sequence:CCGGGCCCAGATACGGACACGCTAACTCGAGTTAGCGTGTCCGTATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024480.2-995s1c1
Sequence:CCGGCCATGCTACCTGTAAGGTGAACTCGAGTTCACCTTACAGGTAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-782s21c1
Sequence:CCGGGAGTCAGCCAGGAAGCTTAACCTCGAGGTTAAGCTTCCTGGCTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024480.2-1253s1c1
Sequence:CCGGCCTGCGTAATCTGGAGCAGATCTCGAGATCTGCTCCAGATTACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-1019s21c1
Sequence:CCGGCTCAACCATGCTACCTGTAAGCTCGAGCTTACAGGTAGCATGGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-1485s21c1
Sequence:CCGGATACGGACACGCTAAGCTTATCTCGAGATAAGCTTAGCGTGTCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024480.4-2056s21c1
Sequence:CCGGCAGGCTTTCACCCGTTGATTCCTCGAGGAATCAACGGGTGAAAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.3-635s21c1
Sequence:CCGGGAACTGGATCCTAGGATACAGCTCGAGCTGTATCCTAGGATCCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024480.3-2062s21c1
Sequence:CCGGCAGAAGGCGTGCCCTAGATATCTCGAGATATCTAGGGCACGCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.3-1149s21c1
Sequence:CCGGTTGAGCTCAAGGCCCAGTTCACTCGAGTGAACTGGGCCTTGAGCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-625s21c1
Sequence:CCGGCAACAGCAGTGAGACCAAATTCTCGAGAATTTGGTCTCACTGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024480
VALIDATED
SH3BP5L MISSION shRNA Lentiviral Transduction Particles
SH3-binding domain protein 5-like
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024480.2-2255s1c1
Sequence:CCGGCCTGTTATCAACACAGGCATTCTCGAGAATGCCTGTGTTGATAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024480.2-690s1c1
Sequence:CCGGGAAATCAACCAGGTGGAGCTACTCGAGTAGCTCCACCTGGTTGATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024480.2-1450s1c1
Sequence:CCGGGCCCAGATACGGACACGCTAACTCGAGTTAGCGTGTCCGTATCTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024480.2-995s1c1
Sequence:CCGGCCATGCTACCTGTAAGGTGAACTCGAGTTCACCTTACAGGTAGCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-782s21c1
Sequence:CCGGGAGTCAGCCAGGAAGCTTAACCTCGAGGTTAAGCTTCCTGGCTGACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024480.2-1253s1c1
Sequence:CCGGCCTGCGTAATCTGGAGCAGATCTCGAGATCTGCTCCAGATTACGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-1019s21c1
Sequence:CCGGCTCAACCATGCTACCTGTAAGCTCGAGCTTACAGGTAGCATGGTTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-1485s21c1
Sequence:CCGGATACGGACACGCTAAGCTTATCTCGAGATAAGCTTAGCGTGTCCGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024480.4-2056s21c1
Sequence:CCGGCAGGCTTTCACCCGTTGATTCCTCGAGGAATCAACGGGTGAAAGCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.3-635s21c1
Sequence:CCGGGAACTGGATCCTAGGATACAGCTCGAGCTGTATCCTAGGATCCAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024480.3-2062s21c1
Sequence:CCGGCAGAAGGCGTGCCCTAGATATCTCGAGATATCTAGGGCACGCCTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.3-1149s21c1
Sequence:CCGGTTGAGCTCAAGGCCCAGTTCACTCGAGTGAACTGGGCCTTGAGCTCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024480.4-625s21c1
Sequence:CCGGCAACAGCAGTGAGACCAAATTCTCGAGAATTTGGTCTCACTGCTGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030645
VALIDATED
SH3BP5L MISSION shRNA Bacterial Glycerol Stock
SH3-binding domain protein 5-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030645.1-2045s21c1
Sequence:CCGGCCCTCTCTTTCCATCTGTTTGCTCGAGCAAACAGATGGAAAGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-833s21c1
Sequence:CCGGAGTCGGCGAGGAAACTGAATACTCGAGTATTCAGTTTCCTCGCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-607s1c1
Sequence:CCGGCGGCCTGAAGTTGTAGAGGATCTCGAGATCCTCTACAACTTCAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030645.1-2268s1c1
Sequence:CCGGCCCGTGTGTAACCTGTAAGATCTCGAGATCTTACAGGTTACACACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-988s1c1
Sequence:CCGGGCTGCTCGAGAAATGGTGTTTCTCGAGAAACACCATTTCTCGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-1332s1c1
Sequence:CCGGCCTTCGTAACCTGGAGCAGATCTCGAGATCTGCTCCAGGTTACGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-769s1c1
Sequence:CCGGGAGATCAACCAGGTGGAACTACTCGAGTAGTTCCACCTGGTTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-810s21c1
Sequence:CCGGCACCTATCGGAGGATCCTACACTCGAGTGTAGGATCCTCCGATAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-675s21c1
Sequence:CCGGCAGCAGCAGTGAGGCCAAATTCTCGAGAATTTGGCCTCACTGCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030645
VALIDATED
SH3BP5L MISSION shRNA shRNA Plasmid DNA
SH3-binding domain protein 5-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030645.1-2045s21c1
Sequence:CCGGCCCTCTCTTTCCATCTGTTTGCTCGAGCAAACAGATGGAAAGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-833s21c1
Sequence:CCGGAGTCGGCGAGGAAACTGAATACTCGAGTATTCAGTTTCCTCGCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-607s1c1
Sequence:CCGGCGGCCTGAAGTTGTAGAGGATCTCGAGATCCTCTACAACTTCAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030645.1-2268s1c1
Sequence:CCGGCCCGTGTGTAACCTGTAAGATCTCGAGATCTTACAGGTTACACACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-988s1c1
Sequence:CCGGGCTGCTCGAGAAATGGTGTTTCTCGAGAAACACCATTTCTCGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-1332s1c1
Sequence:CCGGCCTTCGTAACCTGGAGCAGATCTCGAGATCTGCTCCAGGTTACGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-769s1c1
Sequence:CCGGGAGATCAACCAGGTGGAACTACTCGAGTAGTTCCACCTGGTTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-810s21c1
Sequence:CCGGCACCTATCGGAGGATCCTACACTCGAGTGTAGGATCCTCCGATAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-675s21c1
Sequence:CCGGCAGCAGCAGTGAGGCCAAATTCTCGAGAATTTGGCCTCACTGCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030645
VALIDATED
SH3BP5L MISSION shRNA Lentiviral Transduction Particles
SH3-binding domain protein 5-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030645.1-2045s21c1
Sequence:CCGGCCCTCTCTTTCCATCTGTTTGCTCGAGCAAACAGATGGAAAGAGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-833s21c1
Sequence:CCGGAGTCGGCGAGGAAACTGAATACTCGAGTATTCAGTTTCCTCGCCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-607s1c1
Sequence:CCGGCGGCCTGAAGTTGTAGAGGATCTCGAGATCCTCTACAACTTCAGGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030645.1-2268s1c1
Sequence:CCGGCCCGTGTGTAACCTGTAAGATCTCGAGATCTTACAGGTTACACACGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-988s1c1
Sequence:CCGGGCTGCTCGAGAAATGGTGTTTCTCGAGAAACACCATTTCTCGAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-1332s1c1
Sequence:CCGGCCTTCGTAACCTGGAGCAGATCTCGAGATCTGCTCCAGGTTACGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_030645.1-769s1c1
Sequence:CCGGGAGATCAACCAGGTGGAACTACTCGAGTAGTTCCACCTGGTTGATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-810s21c1
Sequence:CCGGCACCTATCGGAGGATCCTACACTCGAGTGTAGGATCCTCCGATAGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030645.1-675s21c1
Sequence:CCGGCAGCAGCAGTGAGGCCAAATTCTCGAGAATTTGGCCTCACTGCTGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)