EMAIL THIS PAGE TO A FRIEND

SH3D19

SH3 domain containing 19

156 Gene Product Result for
Synonyms: EBP EVE1 Kryn SH3P19
Gene ID:
Human(152503) Summary: This gene encodes a multiple SH3 domain-containing protein, which interacts with other proteins, such as EBP and members of ADAM family, via the SH3 domains. This protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(27059) SH3 domain protein D19
Rat(295171) SH3 domain containing 19
Zebrafish(553811) SH3 domain containing 19
chicken(422478) SH3 domain containing 19
domestic cat(101097638) SH3 domain containing 19
Horse(100062398) SH3 domain containing 19
dog(482645) SH3 domain containing 19
naked mole-rat(101700049) SH3 domain containing 19
Domestic Rabbit(100353862) SH3 domain containing 19
domestic guinea pig(100727056) SH3 domain containing 19
cow(535511) SH3 domain containing 19
sheep(101105530) SH3 domain containing 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009555 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001082414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001082414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001082414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009555 Rosetta Predictions human pricing
XM_001072742 Rosetta Predictions rat pricing
XM_215597 Rosetta Predictions rat pricing
NM_001082414 Rosetta Predictions mouse pricing
XM_994417 Rosetta Predictions mouse pricing
XM_994427 Rosetta Predictions mouse pricing
XM_994437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305627 predicted 1324
2 SASI_Hs01_00177688 predicted 2619
3 SASI_Hs01_00177689 predicted 2610
4 SASI_Hs01_00177690 predicted 1224
5 SASI_Hs01_00177691 predicted 1163
6 SASI_Hs01_00177692 predicted 2264
7 SASI_Hs01_00177695 predicted 2583
8 SASI_Hs02_00305628 predicted 1902
9 SASI_Hs01_00177696 predicted 3026
10 SASI_Hs02_00305629 predicted 2099
11 SASI_Hs01_00177687 predicted 1437
12 SASI_Hs01_00177693 predicted 1877
13 SASI_Hs01_00177694 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340345 predicted 709
2 SASI_Rn02_00340346 predicted 628
3 SASI_Rn02_00340347 predicted 1710
4 SASI_Rn02_00340348 predicted 745
5 SASI_Rn02_00340349 predicted 2855
6 SASI_Rn02_00340350 predicted 2548
7 SASI_Rn02_00340351 predicted 1456
8 SASI_Rn02_00340352 predicted 1697
9 SASI_Rn02_00340353 predicted 686
10 SASI_Rn02_00340354 predicted 2288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376105 predicted 799
2 SASI_Rn02_00376106 predicted 723
3 SASI_Rn02_00376107 predicted 514
4 SASI_Rn02_00376108 predicted 833
5 SASI_Rn02_00376109 predicted 1054
6 SASI_Rn02_00376110 predicted 2937
7 SASI_Rn02_00376111 predicted 2639
8 SASI_Rn02_00376112 predicted 2865
9 SASI_Rn02_00376113 predicted 2537
10 SASI_Rn02_00376114 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299242 predicted 2431
2 SASI_Mm02_00299243 predicted 2352
3 SASI_Mm02_00299244 predicted 546
4 SASI_Mm02_00299245 predicted 279
5 SASI_Mm02_00299246 predicted 1447
6 SASI_Mm02_00299247 predicted 2424
7 SASI_Mm02_00299248 predicted 1085
8 SASI_Mm02_00299249 predicted 1865
9 SASI_Mm02_00299250 predicted 1867
10 SASI_Mm02_00299251 predicted 2013
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248783 predicted 1267
2 SASI_Mm01_00248784 predicted 1891
3 SASI_Mm01_00248785 predicted 1902
4 SASI_Mm01_00248786 predicted 700
5 SASI_Mm01_00248787 predicted 1726
6 SASI_Mm01_00248788 predicted 288
7 SASI_Mm01_00248789 predicted 703
8 SASI_Mm01_00248790 predicted 623
9 SASI_Mm01_00248791 predicted 614
10 SASI_Mm01_00248792 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227229 predicted 2848
2 SASI_Mm01_00227230 predicted 3464
3 SASI_Mm01_00227231 predicted 3480
4 SASI_Mm01_00227232 predicted 2280
5 SASI_Mm01_00227233 predicted 3307
6 SASI_Mm01_00227234 predicted 2293
7 SASI_Mm01_00227235 predicted 2198
8 SASI_Mm01_00227236 predicted 2194
9 SASI_Mm01_00227237 predicted 2543
10 SASI_Mm01_00227238 predicted 3442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265685 predicted 2437
2 SASI_Mm01_00265686 predicted 3060
3 SASI_Mm01_00265687 predicted 3067
4 SASI_Mm01_00265688 predicted 1869
5 SASI_Mm01_00265689 predicted 2904
6 SASI_Mm01_00265690 predicted 1876
7 SASI_Mm01_00265691 predicted 1795
8 SASI_Mm01_00265692 predicted 1775
9 SASI_Mm01_00265693 predicted 2124
10 SASI_Mm01_00265694 predicted 3039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009555
VALIDATED
SH3D19 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2148s21c1
Sequence:CCGGCTGCAACCAGAAGATCTAATACTCGAGTATTAGATCTTCTGGTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2817s21c1
Sequence:CCGGGTGTTGCTCGGTTTGAATATACTCGAGTATATTCAAACCGAGCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009555.1-2610s1c1
Sequence:CCGGGCCAAATAGGTTGAAGACAATCTCGAGATTGTCTTCAACCTATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009555.1-1909s1c1
Sequence:CCGGGCTTGAGCATATCAGCCTTATCTCGAGATAAGGCTGATATGCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009555.3-3510s21c1
Sequence:CCGGATCACCTTGACTATCAGATATCTCGAGATATCTGATAGTCAAGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2703s21c1
Sequence:CCGGGAAACCAGATTGGCATATTTCCTCGAGGAAATATGCCAATCTGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009555.1-1649s1c1
Sequence:CCGGGCTAGGATTCTACCGAGGAAACTCGAGTTTCCTCGGTAGAATCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009555.1-824s1c1
Sequence:CCGGGCAGAAGGATGAGTTGAGTTTCTCGAGAAACTCAACTCATCCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009555.1-1314s1c1
Sequence:CCGGCTTTCCTTCAAGGCTGGAGATCTCGAGATCTCCAGCCTTGAAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009555.1-333s1c1
Sequence:CCGGGCCAATGAAGATATTGTCTCTCTCGAGAGAGACAATATCTTCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009555
VALIDATED
SH3D19 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2148s21c1
Sequence:CCGGCTGCAACCAGAAGATCTAATACTCGAGTATTAGATCTTCTGGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2817s21c1
Sequence:CCGGGTGTTGCTCGGTTTGAATATACTCGAGTATATTCAAACCGAGCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009555.1-2610s1c1
Sequence:CCGGGCCAAATAGGTTGAAGACAATCTCGAGATTGTCTTCAACCTATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009555.1-1909s1c1
Sequence:CCGGGCTTGAGCATATCAGCCTTATCTCGAGATAAGGCTGATATGCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009555.3-3510s21c1
Sequence:CCGGATCACCTTGACTATCAGATATCTCGAGATATCTGATAGTCAAGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2703s21c1
Sequence:CCGGGAAACCAGATTGGCATATTTCCTCGAGGAAATATGCCAATCTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009555.1-1649s1c1
Sequence:CCGGGCTAGGATTCTACCGAGGAAACTCGAGTTTCCTCGGTAGAATCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009555.1-824s1c1
Sequence:CCGGGCAGAAGGATGAGTTGAGTTTCTCGAGAAACTCAACTCATCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009555.1-1314s1c1
Sequence:CCGGCTTTCCTTCAAGGCTGGAGATCTCGAGATCTCCAGCCTTGAAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009555.1-333s1c1
Sequence:CCGGGCCAATGAAGATATTGTCTCTCTCGAGAGAGACAATATCTTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009555
VALIDATED
SH3D19 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2148s21c1
Sequence:CCGGCTGCAACCAGAAGATCTAATACTCGAGTATTAGATCTTCTGGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2817s21c1
Sequence:CCGGGTGTTGCTCGGTTTGAATATACTCGAGTATATTCAAACCGAGCAACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009555.1-2610s1c1
Sequence:CCGGGCCAAATAGGTTGAAGACAATCTCGAGATTGTCTTCAACCTATTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009555.1-1909s1c1
Sequence:CCGGGCTTGAGCATATCAGCCTTATCTCGAGATAAGGCTGATATGCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009555.3-3510s21c1
Sequence:CCGGATCACCTTGACTATCAGATATCTCGAGATATCTGATAGTCAAGGTGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009555.3-2703s21c1
Sequence:CCGGGAAACCAGATTGGCATATTTCCTCGAGGAAATATGCCAATCTGGTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137187    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009555.1-1649s1c1
Sequence:CCGGGCTAGGATTCTACCGAGGAAACTCGAGTTTCCTCGGTAGAATCCTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001009555.1-824s1c1
Sequence:CCGGGCAGAAGGATGAGTTGAGTTTCTCGAGAAACTCAACTCATCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009555.1-1314s1c1
Sequence:CCGGCTTTCCTTCAAGGCTGGAGATCTCGAGATCTCCAGCCTTGAAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009555.1-333s1c1
Sequence:CCGGGCCAATGAAGATATTGTCTCTCTCGAGAGAGACAATATCTTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082414
VALIDATED
SH3D19 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-2933s21c1
Sequence:CCGGCCCATCGACACACCGAATTAACTCGAGTTAATTCGGTGTGTCGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-327s21c1
Sequence:CCGGCCCAAGAAACCCGAGATTATTCTCGAGAATAATCTCGGGTTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-2482s21c1
Sequence:CCGGTCAAGGCTGGAGACGTAATAACTCGAGTTATTACGTCTCCAGCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082414.2-1289s21c1
Sequence:CCGGTGCATCCAAATCATCAAATAACTCGAGTTATTTGATGATTTGGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-1959s21c1
Sequence:CCGGGTCGCACGGTTTGAGTATATTCTCGAGAATATACTCAAACCGTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082414
VALIDATED
SH3D19 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-2933s21c1
Sequence:CCGGCCCATCGACACACCGAATTAACTCGAGTTAATTCGGTGTGTCGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-327s21c1
Sequence:CCGGCCCAAGAAACCCGAGATTATTCTCGAGAATAATCTCGGGTTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-2482s21c1
Sequence:CCGGTCAAGGCTGGAGACGTAATAACTCGAGTTATTACGTCTCCAGCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082414.2-1289s21c1
Sequence:CCGGTGCATCCAAATCATCAAATAACTCGAGTTATTTGATGATTTGGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-1959s21c1
Sequence:CCGGGTCGCACGGTTTGAGTATATTCTCGAGAATATACTCAAACCGTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082414
VALIDATED
SH3D19 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-2933s21c1
Sequence:CCGGCCCATCGACACACCGAATTAACTCGAGTTAATTCGGTGTGTCGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-327s21c1
Sequence:CCGGCCCAAGAAACCCGAGATTATTCTCGAGAATAATCTCGGGTTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-2482s21c1
Sequence:CCGGTCAAGGCTGGAGACGTAATAACTCGAGTTATTACGTCTCCAGCCTTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082414.2-1289s21c1
Sequence:CCGGTGCATCCAAATCATCAAATAACTCGAGTTATTTGATGATTTGGATGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082414.2-1959s21c1
Sequence:CCGGGTCGCACGGTTTGAGTATATTCTCGAGAATATACTCAAACCGTGCGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)