EMAIL THIS PAGE TO A FRIEND

SH3D21

SH3 domain containing 21

74 Gene Product Result for
Synonyms: C1orf113
Gene ID:
Mouse(66938) SH3 domain containing 21
Rat(362598) SH3 domain containing 21
cow(504513) SH3 domain containing 21
sheep(101117295) SH3 domain containing 21
domestic guinea pig(100731022) SH3 domain containing 21
naked mole-rat(101712266) SH3 domain containing 21
domestic cat(101087332) SH3 domain containing 21
dog(608481) SH3 domain containing 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118091 MISSION® esiRNA esiRNA human AL591845.27-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024676 Rosetta Predictions human pricing
XM_342916 Rosetta Predictions rat pricing
NM_025856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357101 predicted 1007
2 SASI_Hs01_00062707 predicted 907
3 SASI_Hs02_00357102 predicted 913
4 SASI_Hs01_00062708 predicted 745
5 SASI_Hs01_00062710 predicted 792
6 SASI_Hs01_00062711 predicted 1580
7 SASI_Hs02_00357103 predicted 1069
8 SASI_Hs01_00062712 predicted 1272
9 SASI_Hs01_00062714 predicted 836
10 SASI_Hs02_00357104 predicted 1587
11 SASI_Hs01_00062705 predicted 1076
12 SASI_Hs01_00062706 predicted 718
13 SASI_Hs01_00062709 predicted 1874
14 SASI_Hs01_00062713 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395031 predicted 1023
2 SASI_Rn02_00395032 predicted 609
3 SASI_Rn02_00395033 predicted 614
4 SASI_Rn02_00395034 predicted 1286
5 SASI_Rn02_00395035 predicted 914
6 SASI_Rn02_00395036 predicted 1799
7 SASI_Rn02_00395037 predicted 1239
8 SASI_Rn02_00395038 predicted 995
9 SASI_Rn02_00395039 predicted 492
10 SASI_Rn02_00395040 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162837 predicted 1085
2 SASI_Mm01_00162838 predicted 852
3 SASI_Mm01_00162839 predicted 1530
4 SASI_Mm01_00162840 predicted 254
5 SASI_Mm01_00162841 predicted 532
6 SASI_Mm01_00162842 predicted 1592
7 SASI_Mm01_00162843 predicted 222
8 SASI_Mm01_00162845 predicted 517
9 SASI_Mm01_00162846 predicted 1032
10 SASI_Mm02_00329146 predicted 522
11 SASI_Mm01_00162844 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025856
SH3D21 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing 21
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-1536s1c1
Sequence:CCGGGTGTTGGAATCCTTAAAGGAACTCGAGTTCCTTTAAGGATTCCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-531s1c1
Sequence:CCGGCTGATGCCTAAATCATCTCTACTCGAGTAGAGATGATTTAGGCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-356s1c1
Sequence:CCGGCCTGGTGAAAGTTCTGAGAAACTCGAGTTTCTCAGAACTTTCACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-371s1c1
Sequence:CCGGGAGAAAGACAACTGAGGATAACTCGAGTTATCCTCAGTTGTCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025856
SH3D21 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing 21
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-1536s1c1
Sequence:CCGGGTGTTGGAATCCTTAAAGGAACTCGAGTTCCTTTAAGGATTCCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-531s1c1
Sequence:CCGGCTGATGCCTAAATCATCTCTACTCGAGTAGAGATGATTTAGGCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-356s1c1
Sequence:CCGGCCTGGTGAAAGTTCTGAGAAACTCGAGTTTCTCAGAACTTTCACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-371s1c1
Sequence:CCGGGAGAAAGACAACTGAGGATAACTCGAGTTATCCTCAGTTGTCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025856
SH3D21 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing 21
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-1536s1c1
Sequence:CCGGGTGTTGGAATCCTTAAAGGAACTCGAGTTCCTTTAAGGATTCCAACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-531s1c1
Sequence:CCGGCTGATGCCTAAATCATCTCTACTCGAGTAGAGATGATTTAGGCATCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-356s1c1
Sequence:CCGGCCTGGTGAAAGTTCTGAGAAACTCGAGTTTCTCAGAACTTTCACCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025856.1-371s1c1
Sequence:CCGGGAGAAAGACAACTGAGGATAACTCGAGTTATCCTCAGTTGTCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024676
SH3D21 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing 21
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1473s1c1
Sequence:CCGGCATAGAAAGAGCCTTTGCCCACTCGAGTGGGCAAAGGCTCTTTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1436s1c1
Sequence:CCGGCTAAAGAGGAAGTGGCTCCAACTCGAGTTGGAGCCACTTCCTCTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1066s1c1
Sequence:CCGGCAGAAGGTCAAGTACTTTGTACTCGAGTACAAAGTACTTGACCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024676.2-2695s1c1
Sequence:CCGGGCATGCAATGTGGTGTGTGATCTCGAGATCACACACCACATTGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1072s1c1
Sequence:CCGGGTCAAGTACTTTGTAGCCAAACTCGAGTTTGGCTACAAAGTACTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024676.4-468s21c1
Sequence:CCGGAGCAAGACCACAGAGGATAAGCTCGAGCTTATCCTCTGTGGTCTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024676.4-2153s21c1
Sequence:CCGGACGTCCTTGCACACGACTTTGCTCGAGCAAAGTCGTGTGCAAGGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024676
SH3D21 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing 21
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1473s1c1
Sequence:CCGGCATAGAAAGAGCCTTTGCCCACTCGAGTGGGCAAAGGCTCTTTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1436s1c1
Sequence:CCGGCTAAAGAGGAAGTGGCTCCAACTCGAGTTGGAGCCACTTCCTCTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1066s1c1
Sequence:CCGGCAGAAGGTCAAGTACTTTGTACTCGAGTACAAAGTACTTGACCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024676.2-2695s1c1
Sequence:CCGGGCATGCAATGTGGTGTGTGATCTCGAGATCACACACCACATTGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1072s1c1
Sequence:CCGGGTCAAGTACTTTGTAGCCAAACTCGAGTTTGGCTACAAAGTACTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024676.4-468s21c1
Sequence:CCGGAGCAAGACCACAGAGGATAAGCTCGAGCTTATCCTCTGTGGTCTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024676.4-2153s21c1
Sequence:CCGGACGTCCTTGCACACGACTTTGCTCGAGCAAAGTCGTGTGCAAGGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024676
SH3D21 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing 21
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1473s1c1
Sequence:CCGGCATAGAAAGAGCCTTTGCCCACTCGAGTGGGCAAAGGCTCTTTCTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1436s1c1
Sequence:CCGGCTAAAGAGGAAGTGGCTCCAACTCGAGTTGGAGCCACTTCCTCTTTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1066s1c1
Sequence:CCGGCAGAAGGTCAAGTACTTTGTACTCGAGTACAAAGTACTTGACCTTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024676.2-2695s1c1
Sequence:CCGGGCATGCAATGTGGTGTGTGATCTCGAGATCACACACCACATTGCATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024676.2-1072s1c1
Sequence:CCGGGTCAAGTACTTTGTAGCCAAACTCGAGTTTGGCTACAAAGTACTTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024676.4-468s21c1
Sequence:CCGGAGCAAGACCACAGAGGATAAGCTCGAGCTTATCCTCTGTGGTCTTGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024676.4-2153s21c1
Sequence:CCGGACGTCCTTGCACACGACTTTGCTCGAGCAAAGTCGTGTGCAAGGACGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)